Rmu_sc0004311.1_g000007

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004311.1
OG0002359
Physical Location & Seq
Reverse (-)
29569 .. 29971
403 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004311.1_g000007.1.cds

Sequence Viewer

Length: 324 bp
atggtccttttggcttctcgagctggcgtcaaggttgctagtgatgggttggtgagatctggttcttctttctccatgttgagcggttgtgggcacgaaatcaagggtgtcggcttggagattgggatccagcgtttagactcgggtctggctgtttattgggattttctgtatgatggtattgcgacgatgctggtcttccttgaagggggtggcagtttgcttgatcacagaaagctgtggtggtggattgtcattgtgtgcatgaggcaggtttctgcacagggaagaagaggttgggccttggtttttgtcttcttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.77

Weight (kDa)

8.77

Isoelectric Point (pI)

27.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 262
AccBSI CCGCTC 1 cut(s) 84
AciI CCGC 1 cut(s) 84
AclWI GGATC 2 cut(s) 121, 134
AcyI GRCGYC 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 208
AgsI TTSAA 1 cut(s) 206
AjuI GAANNNNNNNTTGG 2 cut(s) 280, 312
AluBI AGCT 2 cut(s) 23, 238
AluI AGCT 2 cut(s) 23, 238
AlwI GGATC 2 cut(s) 121, 134
Ama87I CYCGRG 2 cut(s) 18, 142
AoxI GGCC 1 cut(s) 300
AspS9I GGNCC 2 cut(s) 4, 300
AsuHPI GGTGA 1 cut(s) 64
AvaI CYCGRG 2 cut(s) 18, 142
AvaII GGWCC 1 cut(s) 4
BaeGI GKGCMC 1 cut(s) 96
BamHI GGATCC 1 cut(s) 126
BbsI GAAGAC 2 cut(s) 190, 307
BccI CCATC 2 cut(s) 38, 170
BclI TGATCA 1 cut(s) 226
BfaI CTAG 1 cut(s) 39
BfuAI ACCTGC 1 cut(s) 262
BglII AGATCT 1 cut(s) 56
Bme18I GGWCC 1 cut(s) 4
BmeT110I CYCGRG 2 cut(s) 18, 142
BmgT120I GGNCC 2 cut(s) 4, 300
BmiI GGNNCC 1 cut(s) 128
BmsI GCATC 1 cut(s) 180
BoxI GACNNNNGTC 1 cut(s) 144
BpiI GAAGAC 2 cut(s) 190, 307
BsaBI GATNNNNATC 1 cut(s) 125
BsaHI GRCGYC 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 303
Bsc4I CCNNNNNNNGG 1 cut(s) 208
Bse8I GATNNNNATC 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 303
BseJI GATNNNNATC 1 cut(s) 125
BseLI CCNNNNNNNGG 1 cut(s) 208
BseSI GKGCMC 1 cut(s) 96
BsgI GTGCAG 1 cut(s) 264
BshFI GGCC 1 cut(s) 302
BsiHKCI CYCGRG 2 cut(s) 18, 142
BslI CCNNNNNNNGG 1 cut(s) 208
BsnI GGCC 1 cut(s) 302
BsoBI CYCGRG 2 cut(s) 18, 142
Bsp1286I GDGCHC 1 cut(s) 96
Bsp143I GATC 3 cut(s) 56, 126, 226
BspACI CCGC 1 cut(s) 84
BspANI GGCC 1 cut(s) 302
BspLI GGNNCC 1 cut(s) 128
BspMI ACCTGC 1 cut(s) 262
BspPI GGATC 2 cut(s) 121, 134
BsrBI CCGCTC 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 303
BssMI GATC 3 cut(s) 56, 126, 226
BssNI GRCGYC 1 cut(s) 27
BssT1I CCWWGG 1 cut(s) 303
Bst6I CTCTTC 1 cut(s) 286
BstACI GRCGYC 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 25
BstKTI GATC 3 cut(s) 59, 129, 229
BstMBI GATC 3 cut(s) 56, 126, 226
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstPAI GACNNNNGTC 1 cut(s) 144
BstSLI GKGCMC 1 cut(s) 96
BstV2I GAAGAC 2 cut(s) 190, 307
BstX2I RGATCY 2 cut(s) 56, 126
BstYI RGATCY 2 cut(s) 56, 126
BsuRI GGCC 1 cut(s) 302
BveI ACCTGC 1 cut(s) 262
Cac8I GCNNGC 1 cut(s) 25
Cfr13I GGNCC 2 cut(s) 4, 300
CseI GACGC 1 cut(s) 16
CviAII CATG 2 cut(s) 76, 265
CviJI RGCY 6 cut(s) 14, 23, 114, 152, 238, 302
CviKI_1 RGCY 6 cut(s) 14, 23, 114, 152, 238, 302
DpnI GATC 3 cut(s) 58, 128, 228
DpnII GATC 3 cut(s) 56, 126, 226
Eam1104I CTCTTC 1 cut(s) 286
EarI CTCTTC 1 cut(s) 286
Eco130I CCWWGG 1 cut(s) 303
Eco47I GGWCC 1 cut(s) 4
Eco88I CYCGRG 2 cut(s) 18, 142
EcoT14I CCWWGG 1 cut(s) 303
ErhI CCWWGG 1 cut(s) 303
FaeI CATG 2 cut(s) 79, 268
FaiI YATR 3 cut(s) 77, 174, 266
FatI CATG 2 cut(s) 75, 264
FbaI TGATCA 1 cut(s) 226
FspBI CTAG 1 cut(s) 39
HaeIII GGCC 1 cut(s) 302
HgaI GACGC 1 cut(s) 16
Hin1I GRCGYC 1 cut(s) 27
Hin1II CATG 2 cut(s) 79, 268
HinfI GANTC 1 cut(s) 140
HphI GGTGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 18
Hpy99I CGWCG 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 200
HpyCH4V TGCA 2 cut(s) 264, 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
Hsp92I GRCGYC 1 cut(s) 27
Hsp92II CATG 2 cut(s) 79, 268
Ksp22I TGATCA 1 cut(s) 226
Kzo9I GATC 3 cut(s) 56, 126, 226
LpnPI CCDG 7 cut(s) 9, 45, 134, 143, 179, 257, 269
LweI GCATC 1 cut(s) 180
MaeI CTAG 1 cut(s) 39
MalI GATC 3 cut(s) 58, 128, 228
MbiI CCGCTC 1 cut(s) 84
MboI GATC 3 cut(s) 56, 126, 226
MboII GAAGA 5 cut(s) 57, 190, 300, 303, 307
MflI RGATCY 2 cut(s) 56, 126
MhlI GDGCHC 1 cut(s) 96
MlyI GAGTC 1 cut(s) 134
MnlI CCTC 2 cut(s) 261, 287
MwoI GCNNNNNNNGC 1 cut(s) 20
NdeII GATC 3 cut(s) 56, 126, 226
NlaIII CATG 2 cut(s) 79, 268
NlaIV GGNNCC 1 cut(s) 128
PaeR7I CTCGAG 1 cut(s) 18
PleI GAGTC 1 cut(s) 134
PpsI GAGTC 1 cut(s) 134
PshAI GACNNNNGTC 1 cut(s) 144
PspN4I GGNNCC 1 cut(s) 128
PspPI GGNCC 2 cut(s) 4, 300
PsuI RGATCY 2 cut(s) 56, 126
Sau3AI GATC 3 cut(s) 56, 126, 226
Sau96I GGNCC 2 cut(s) 4, 300
SchI GAGTC 1 cut(s) 134
SduI GDGCHC 1 cut(s) 96
SetI ASST 5 cut(s) 25, 36, 240, 276, 298
SfaNI GCATC 1 cut(s) 180
Sfr274I CTCGAG 1 cut(s) 18
SinI GGWCC 1 cut(s) 4
SlaI CTCGAG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 18
SmoI CTYRAG 1 cut(s) 18
SsiI CCGC 1 cut(s) 84
SspMI CTAG 1 cut(s) 39
StyI CCWWGG 1 cut(s) 303
TaqI TCGA 1 cut(s) 19
VpaK11BI GGWCC 1 cut(s) 4
XhoI CTCGAG 1 cut(s) 18
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.