Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004324.1

Orthogroup ID

OG0005992

Physical Location & Seq

Genomic Coordinates Reverse (-)

16229 .. 24861

Gene Structure 8633 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004324.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2361 bp

atgattaccaattttcgttggtgtcagaaaccaattacgcaaatatcagacaggggagatccctccggccaatcacatccgtccattaccgagcccttagatatccacgttcgcgaatcccaagaaaatactctgtttctttggttgaataaaagacttgttcttgggatcggaaagtgtttggttccgagaggactctgtttaagcgatcgggtgttgttctctaagactgactttcctgttccccccaaacatcccacaactgttacaggtttccagtttttttgggttgggtatgtgatctgtgtcaatacaactgggcgagaagatttcaaagttgagacaaatatggcaacttattatactaattcaaataatcaaaaggacggtacgccaatgctctattcaagggaacctttaactagttcatatccagaaacacccgttcttcctggtaacatgatgatgtatatgaactcggggtcatactcggatgcattagctgggagttctcagcagcaaaacaactgcattgaagtcgtttcctcagtgggggcttcagattccaatacacaacagcaggatgtcttatcacatcttggtggctcacgtattggagagcaaggattcaatgcatggagagatagtagaaatgagatgctagttacgaatccgatggatggttctgcagctattcttcatggtggacagaacttgcaaggccagggattgtccctcagcctctcatcaggaatgcaagtgccttctatgtcataccggaatcccaatatgggttttgcttcattcttaagtcctaatccatcactgtcaactgagggcaggaatggcactttcagagatgaccagccaagaaatgttgaatatttgcaacctagttttcttggaggcaatgcggattcaagtaaaggggatttgtctccatatgggatgtcgagtattgcaaggaacgttcccaattccaagtatctgaaagcagcacaacaactgctcgatgaagttgtcaacgtccagaaagcactgaagcagcgtgacagggagaagaacgaaagcacaaatgagcatatgatgaagagtttcaaggagggtgatgatggttcaaagaatgagcttgaaagtggagaatcttcaaacccccaagagtccgccagtaattcatcgtgtgagctttcacatgctgagaaacaagagttgcaaaacaagctgactaagcttctgtctatgttagatgaggttgatagaaggtacaaacactattatcagcagatgcagattgtggtatcatcatttgatgcgatagcaggaagtggggcagctaaaccatacacagcagttgctcttcaaacaatttctcgccactttcgatgcttacgtgatgcaatcacaggccagatacgagcaacccaaaaaagccttggggagcaaggtacttcaggaagcattaaaggggttggaattactcgcctccgtttcgtggatcagcagctcaggcagcagagagcccttcagcagcttggtatgatgcaacaacatgcatggaggccacaaagaggtctgccagaaagttctgtttcgattctgcgagcatggctgtttgagcatttccttcatccctatcccaaggattctgataagatcatgctagcaaggcagacaggcttgaccagaagtcaggtctcaaactggtttataaatgcacgggtgcgtctctggaaacccatggttgaggagatgtacaaagaagaggctggtgatgctgaaatggactctaattcttcatctgaaaatgcaccccaaaccaaaaaaggtgagaagaggaccttggaagacggaggggaagatatgcagcctagtgcaagttccacaggcactgatagatgcagcacgggacaatttatggactccaaacctgatcattatgatgtggaaatggctggatccactgggtctgccagcttccaaaatgggactcgtcgtgaagctgaagctgaatttgggctagtgaagcttaggcagggagaaaggcctggcatggatgaaagtagtttctttactgatggaatggttcagtctgataggagcagcgaaaggtttatggctgcataccacatgcgggagttggggaggtttggaagtggaagcggcgtgtctctaacattggggttgcagcattgtgatggtggtaacattcctatctctagtgggactcctcacagttttgttgccatgagagatgatgatttgtacaatgcagcagcgtcttccgttgggtcagagaccgcagatttcgaccagcagcacagatttggttcctcccatctattacgcgatttcgtagtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001067 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0044212 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Homeobox_KN POX

Protein Analysis

786

Amino Acids

87.04

Weight (kDa)

5.96

Isoelectric Point (pI)

43.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005992)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G16400
fragaria_vesca	FvH4_2g09770 FvH4_2g09770 FvH4_2g09770
malus_domestica	MD05G1059800.v1.1 MD10G1068000.v1.1
prunus_persica	Prupe.8G089800_v2.0.a1 Prupe.8G089800_v2.0.a1 Prupe.8G089800_v2.0.a1
pyrus_communis	pycom05g05110 pycom05g05120 pycom10g05380
rosa_chinensis	RchiOBHm_Chr6g0266091 RchiOBHm_Chr6g0266111
rosa_laevigata	RLG00000014115
rosa_multiflora	Rmu_co8443717.1_g000001 Rmu_sc0004324.1_g000004
rosa_roxburghii	Rroxscaffold_174G00435200 Rroxscaffold_7G00201970
rosa_rugosa	Rorug06G0023900 Rorug06G0024000 Rorug06G0024100
rosa_samantha	Rh6AG144700 Rh6BG145100 Rh6CG141800 Rh6DG129400
rosa_wichuraiana	Rw6G012490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1709
AccII	CGCG	2 cut(s)	114, 2346
AciI	CCGC	5 cut(s)	914, 1164, 2131, 2160, 2298
AclI	AACGTT	1 cut(s)	969
AclWI	GGATC	5 cut(s)	53, 176, 1503, 1950, 1963
AcoI	YGGCCR	1 cut(s)	67
AcsI	RAATTY	1 cut(s)	2009
AcuI	CTGAAG	5 cut(s)	543, 1061, 1434, 1508, 2022
AfaI	GTAC	5 cut(s)	391, 1265, 1447, 1754, 2264
AfiI	CCNNNNNNNGG	6 cut(s)	552, 680, 791, 1492, 1568, 2131
AflII	CTTAAG	1 cut(s)	808
AhdI	GACNNNNNGTC	1 cut(s)	1686
AhlI	ACTAGT	1 cut(s)	422
AjnI	CCWGG	3 cut(s)	451, 723, 2044
AjuI	GAANNNNNNNTTGG	6 cut(s)	388, 420, 1823, 1855, 1995, 2027
Alw26I	GTCTC	6 cut(s)	335, 942, 1699, 1730, 2172, 2288
AlwI	GGATC	5 cut(s)	53, 176, 1503, 1950, 1963
AlwNI	CAGNNNCTG	1 cut(s)	1889
Ama87I	CYCGRG	1 cut(s)	478
AoxI	GGCC	5 cut(s)	67, 721, 1405, 1559, 2042
ApoI	RAATTY	1 cut(s)	2009
Asp700I	GAANNNNTTC	1 cut(s)	1094
AspS9I	GGNCC	1 cut(s)	1836
AsuHPI	GGTGA	3 cut(s)	1118, 1781, 1838
AsuNHI	GCTAGC	1 cut(s)	1660
AvaI	CYCGRG	1 cut(s)	478
AvaII	GGWCC	1 cut(s)	1836
BamHI	GGATCC	1 cut(s)	1955
BanII	GRGCYC	2 cut(s)	96, 1522
BbsI	GAAGAC	2 cut(s)	1851, 2271
BbvCI	CCTCAGC	1 cut(s)	737
BccI	CCATC	7 cut(s)	670, 674, 829, 1106, 2069, 2189, 2343
BcgI	CGANNNNNNTGC	2 cut(s)	520, 554
BciT130I	CCWGG	3 cut(s)	453, 725, 2046
BclI	TGATCA	1 cut(s)	1930
BcoDI	GTCTC	6 cut(s)	335, 942, 1699, 1730, 2172, 2288
BcuI	ACTAGT	1 cut(s)	422
BfaI	CTAG	7 cut(s)	423, 662, 894, 1661, 1869, 2018, 2217
BfmI	CTRYAG	1 cut(s)	687
BfrI	CTTAAG	1 cut(s)	808
Bme1390I	CCNGG	3 cut(s)	453, 725, 2046
Bme18I	GGWCC	1 cut(s)	1836
BmeRI	GACNNNNNGTC	1 cut(s)	1686
BmeT110I	CYCGRG	1 cut(s)	478
BmgT120I	GGNCC	1 cut(s)	1836
BmiI	GGNNCC	4 cut(s)	186, 414, 1957, 2329
BmrFI	CCNGG	3 cut(s)	453, 725, 2046
BmrI	ACTGGG	2 cut(s)	327, 1971
BmsI	GCATC	9 cut(s)	484, 648, 1275, 1300, 1373, 1384, 1530, 1762, 1886
BmtI	GCTAGC	1 cut(s)	1664
BmuI	ACTGGG	2 cut(s)	327, 1971
BpiI	GAAGAC	2 cut(s)	1851, 2271
Bpu10I	CCTNAGC	3 cut(s)	737, 1505, 2027
BsaAI	YACGTR	2 cut(s)	611, 1391
BsaI	GGTCTC	2 cut(s)	1699, 2288
BsaJI	CCNNGG	5 cut(s)	724, 1432, 1638, 1737, 1839
BsaWI	WCCGGW	1 cut(s)	777
BsaXI	ACNNNNNCTCC	2 cut(s)	631, 661
Bsc4I	CCNNNNNNNGG	6 cut(s)	552, 680, 791, 1492, 1568, 2131
Bse1I	ACTGG	5 cut(s)	277, 322, 1167, 1706, 1966
Bse3DI	GCAATG	1 cut(s)	916
BseBI	CCWGG	3 cut(s)	453, 725, 2046
BseDI	CCNNGG	5 cut(s)	724, 1432, 1638, 1737, 1839
BseGI	GGATG	8 cut(s)	76, 253, 499, 589, 685, 954, 1627, 2059
BseLI	CCNNNNNNNGG	6 cut(s)	552, 680, 791, 1492, 1568, 2131
BseMI	GCAATG	1 cut(s)	916
BseMII	CTCAG	6 cut(s)	527, 561, 751, 825, 1188, 1519
BseNI	ACTGG	5 cut(s)	277, 322, 1167, 1706, 1966
BseRI	GAGGAG	2 cut(s)	1760, 2217
BseYI	CCCAGC	1 cut(s)	503
Bsh1236I	CGCG	2 cut(s)	114, 2346
Bsh1285I	CGRYCG	1 cut(s)	211
BshFI	GGCC	5 cut(s)	69, 723, 1407, 1561, 2044
BsiEI	CGRYCG	1 cut(s)	211
BsiHKCI	CYCGRG	1 cut(s)	478
BsiSI	CCGG	2 cut(s)	66, 778
BslFI	GGGAC	4 cut(s)	718, 1920, 1999, 2236
BslI	CCNNNNNNNGG	6 cut(s)	552, 680, 791, 1492, 1568, 2131
BsmAI	GTCTC	6 cut(s)	335, 942, 1699, 1730, 2172, 2288
BsmBI	CGTCTC	1 cut(s)	1730
BsmFI	GGGAC	4 cut(s)	718, 1920, 1999, 2236
BsmI	GAATGC	1 cut(s)	759
BsnI	GGCC	5 cut(s)	69, 723, 1407, 1561, 2044
Bso31I	GGTCTC	2 cut(s)	1699, 2288
BsoBI	CYCGRG	1 cut(s)	478
Bsp1286I	GDGCHC	2 cut(s)	96, 1522
Bsp1407I	TGTACA	2 cut(s)	1752, 2262
Bsp143I	GATC	8 cut(s)	58, 168, 208, 300, 1495, 1653, 1930, 1955
Bsp19I	CCATGG	1 cut(s)	1737
Bsp68I	TCGCGA	1 cut(s)	114
BspACI	CCGC	5 cut(s)	914, 1164, 2131, 2160, 2298
BspANI	GGCC	5 cut(s)	69, 723, 1407, 1561, 2044
BspCNI	CTCAG	6 cut(s)	526, 560, 750, 826, 1189, 1518
BspFNI	CGCG	2 cut(s)	114, 2346
BspLI	GGNNCC	4 cut(s)	186, 414, 1957, 2329
BspMAI	CTGCAG	1 cut(s)	691
BspOI	GCTAGC	1 cut(s)	1664
BspPI	GGATC	5 cut(s)	53, 176, 1503, 1950, 1963
BspQI	GCTCTTC	1 cut(s)	1362
BspTI	CTTAAG	1 cut(s)	808
BspTNI	GGTCTC	2 cut(s)	1699, 2288
BsrDI	GCAATG	1 cut(s)	916
BsrGI	TGTACA	2 cut(s)	1752, 2262
BsrI	ACTGG	5 cut(s)	277, 322, 1167, 1706, 1966
BssECI	CCNNGG	5 cut(s)	724, 1432, 1638, 1737, 1839
BssMI	GATC	8 cut(s)	58, 168, 208, 300, 1495, 1653, 1930, 1955
BssT1I	CCWWGG	4 cut(s)	1432, 1638, 1737, 1839
Bst2UI	CCWGG	3 cut(s)	453, 725, 2046
Bst4CI	ACNGT	4 cut(s)	265, 389, 828, 2234
Bst6I	CTCTTC	4 cut(s)	1085, 1362, 1755, 1826
BstAFI	CTTAAG	1 cut(s)	808
BstAUI	TGTACA	2 cut(s)	1752, 2262
BstBAI	YACGTR	2 cut(s)	611, 1391
BstC8I	GCNNGC	3 cut(s)	1602, 1662, 1972
BstDSI	CCRYGG	1 cut(s)	1737
BstF5I	GGATG	8 cut(s)	76, 253, 499, 589, 685, 954, 1627, 2059
BstFNI	CGCG	2 cut(s)	114, 2346
BstKTI	GATC	8 cut(s)	61, 171, 211, 303, 1498, 1656, 1933, 1958
BstMAI	GTCTC	6 cut(s)	335, 942, 1699, 1730, 2172, 2288
BstMBI	GATC	8 cut(s)	58, 168, 208, 300, 1495, 1653, 1930, 1955
BstMCI	CGRYCG	1 cut(s)	211
BstNI	CCWGG	3 cut(s)	453, 725, 2046
BstNSI	RCATGY	3 cut(s)	1196, 1553, 2131
BstSCI	CCNGG	3 cut(s)	451, 723, 2044
BstSFI	CTRYAG	1 cut(s)	687
BstUI	CGCG	2 cut(s)	114, 2346
BstV2I	GAAGAC	2 cut(s)	1851, 2271
BstX2I	RGATCY	2 cut(s)	58, 1955
BstYI	RGATCY	2 cut(s)	58, 1955
BsuRI	GGCC	5 cut(s)	69, 723, 1407, 1561, 2044
BtgI	CCRYGG	1 cut(s)	1737
BtsCI	GGATG	8 cut(s)	76, 253, 499, 589, 685, 954, 1627, 2059
BtsIMutI	CAGTG	5 cut(s)	555, 824, 1037, 1887, 1959
BtuMI	TCGCGA	1 cut(s)	114
Cac8I	GCNNGC	3 cut(s)	1602, 1662, 1972
CaiI	CAGNNNCTG	1 cut(s)	1889
Cfr13I	GGNCC	1 cut(s)	1836
CseI	GACGC	2 cut(s)	1712, 2265
Csp6I	GTAC	5 cut(s)	390, 1264, 1446, 1753, 2263
CviQI	GTAC	5 cut(s)	390, 1264, 1446, 1753, 2263
DpnI	GATC	8 cut(s)	60, 170, 210, 302, 1497, 1655, 1932, 1957
DpnII	GATC	8 cut(s)	58, 168, 208, 300, 1495, 1653, 1930, 1955
DriI	GACNNNNNGTC	1 cut(s)	1686
EaeI	YGGCCR	1 cut(s)	67
Eam1104I	CTCTTC	4 cut(s)	1085, 1362, 1755, 1826
Eam1105I	GACNNNNNGTC	1 cut(s)	1686
EarI	CTCTTC	4 cut(s)	1085, 1362, 1755, 1826
EciI	GGCGGA	1 cut(s)	1153
Eco130I	CCWWGG	4 cut(s)	1432, 1638, 1737, 1839
Eco147I	AGGCCT	1 cut(s)	2044
Eco24I	GRGCYC	2 cut(s)	96, 1522
Eco31I	GGTCTC	2 cut(s)	1699, 2288
Eco32I	GATATC	1 cut(s)	103
Eco47I	GGWCC	1 cut(s)	1836
Eco57I	CTGAAG	5 cut(s)	543, 1061, 1434, 1508, 2022
Eco88I	CYCGRG	1 cut(s)	478
EcoO109I	RGGNCCY	1 cut(s)	1836
EcoRII	CCWGG	3 cut(s)	451, 723, 2044
EcoRV	GATATC	1 cut(s)	103
EcoT14I	CCWWGG	4 cut(s)	1432, 1638, 1737, 1839
EcoT22I	ATGCAT	3 cut(s)	499, 637, 1555
EcoT38I	GRGCYC	2 cut(s)	96, 1522
ErhI	CCWWGG	4 cut(s)	1432, 1638, 1737, 1839
Esp3I	CGTCTC	1 cut(s)	1730
FalI	AAGNNNNNCTT	6 cut(s)	218, 250, 400, 432, 1823, 1855
FaqI	GGGAC	4 cut(s)	718, 1920, 1999, 2236
FauI	CCCGC	1 cut(s)	2124
FauNDI	CATATG	2 cut(s)	943, 1083
FbaI	TGATCA	1 cut(s)	1930
FokI	GGATG	8 cut(s)	63, 240, 506, 596, 692, 961, 1614, 2066
FriOI	GRGCYC	2 cut(s)	96, 1522
FspBI	CTAG	7 cut(s)	423, 662, 894, 1661, 1869, 2018, 2217
GsaI	CCCAGC	1 cut(s)	507
HaeIII	GGCC	5 cut(s)	69, 723, 1407, 1561, 2044
HapII	CCGG	2 cut(s)	66, 778
HgaI	GACGC	2 cut(s)	1712, 2265
HincII	GTYRAC	2 cut(s)	831, 1024
HindII	GTYRAC	2 cut(s)	831, 1024
HindIII	AAGCTT	2 cut(s)	1229, 2024
HpaII	CCGG	2 cut(s)	66, 778
HphI	GGTGA	3 cut(s)	1118, 1781, 1838
Hpy166II	GTNNAC	3 cut(s)	707, 831, 1024
Hpy188III	TCNNGA	7 cut(s)	113, 434, 750, 1030, 1452, 1729, 1994
Hpy8I	GTNNAC	3 cut(s)	707, 831, 1024
Hpy99I	CGWCG	1 cut(s)	1995
HpyAV	CCTTC	4 cut(s)	774, 1254, 1532, 1634
HpyCH4III	ACNGT	4 cut(s)	265, 389, 828, 2234
HpyCH4IV	ACGT	5 cut(s)	108, 610, 969, 1026, 1390
HpySE526I	ACGT	5 cut(s)	108, 610, 969, 1026, 1390
Ksp22I	TGATCA	1 cut(s)	1930
Kzo9I	GATC	8 cut(s)	58, 168, 208, 300, 1495, 1653, 1930, 1955
LguI	GCTCTTC	1 cut(s)	1362
LmnI	GCTCC	2 cut(s)	1438, 2097
LweI	GCATC	9 cut(s)	484, 648, 1275, 1300, 1373, 1384, 1530, 1762, 1886
MaeI	CTAG	7 cut(s)	423, 662, 894, 1661, 1869, 2018, 2217
MaeII	ACGT	5 cut(s)	108, 610, 969, 1026, 1390
MaeIII	GTNAC	5 cut(s)	265, 455, 664, 1049, 2201
MalI	GATC	8 cut(s)	60, 170, 210, 302, 1497, 1655, 1932, 1957
MboI	GATC	8 cut(s)	58, 168, 208, 300, 1495, 1653, 1930, 1955
MflI	RGATCY	2 cut(s)	58, 1955
MhlI	GDGCHC	2 cut(s)	96, 1522
MlyI	GAGTC	6 cut(s)	189, 1169, 1778, 1913, 1981, 2218
MmeI	TCCRAC	1 cut(s)	1450
Mph1103I	ATGCAT	3 cut(s)	499, 637, 1555
MroXI	GAANNNNTTC	1 cut(s)	1094
MseI	TTAA	4 cut(s)	203, 419, 809, 1461
MslI	CAYNNNNRTG	4 cut(s)	464, 600, 1938, 2193
MspCI	CTTAAG	1 cut(s)	808
MspI	CCGG	2 cut(s)	66, 778
MspR9I	CCNGG	3 cut(s)	453, 725, 2046
Mva1269I	GAATGC	1 cut(s)	759
MvaI	CCWGG	3 cut(s)	453, 725, 2046
MvnI	CGCG	2 cut(s)	114, 2346
NcoI	CCATGG	1 cut(s)	1737
NdeI	CATATG	2 cut(s)	943, 1083
NdeII	GATC	8 cut(s)	58, 168, 208, 300, 1495, 1653, 1930, 1955
NheI	GCTAGC	1 cut(s)	1660
NlaIV	GGNNCC	4 cut(s)	186, 414, 1957, 2329
NmuCI	GTSAC	1 cut(s)	1049
NruI	TCGCGA	1 cut(s)	114
NsiI	ATGCAT	3 cut(s)	499, 637, 1555
NspI	RCATGY	3 cut(s)	1196, 1553, 2131
PceI	AGGCCT	1 cut(s)	2044
PciSI	GCTCTTC	1 cut(s)	1362
PcsI	WCGNNNNNNNCGW	2 cut(s)	1378, 1387
PctI	GAATGC	1 cut(s)	759
PdmI	GAANNNNTTC	1 cut(s)	1094
PfeI	GAWTC	9 cut(s)	116, 563, 627, 670, 781, 917, 1142, 1594, 1643
Ple19I	CGATCG	1 cut(s)	211
PleI	GAGTC	6 cut(s)	189, 1168, 1778, 1913, 1981, 2218
PpsI	GAGTC	6 cut(s)	189, 1168, 1778, 1913, 1981, 2218
Ppu21I	YACGTR	2 cut(s)	611, 1391
PpuMI	RGGWCCY	1 cut(s)	1836
PsiI	TTATAA	1 cut(s)	1709
Psp1406I	AACGTT	1 cut(s)	969
Psp5II	RGGWCCY	1 cut(s)	1836
Psp6I	CCWGG	3 cut(s)	451, 723, 2044
PspFI	CCCAGC	1 cut(s)	503
PspGI	CCWGG	3 cut(s)	451, 723, 2044
PspN4I	GGNNCC	4 cut(s)	186, 414, 1957, 2329
PspPI	GGNCC	1 cut(s)	1836
PspPPI	RGGWCCY	1 cut(s)	1836
PstI	CTGCAG	1 cut(s)	691
PstNI	CAGNNNCTG	1 cut(s)	1889
PsuI	RGATCY	2 cut(s)	58, 1955
PvuI	CGATCG	1 cut(s)	211
RruI	TCGCGA	1 cut(s)	114
RsaI	GTAC	5 cut(s)	391, 1265, 1447, 1754, 2264
RsaNI	GTAC	5 cut(s)	390, 1264, 1446, 1753, 2263
RseI	CAYNNNNRTG	4 cut(s)	464, 600, 1938, 2193
SapI	GCTCTTC	1 cut(s)	1362
SaqAI	TTAA	4 cut(s)	203, 419, 809, 1461
Sau3AI	GATC	8 cut(s)	58, 168, 208, 300, 1495, 1653, 1930, 1955
Sau96I	GGNCC	1 cut(s)	1836
SchI	GAGTC	6 cut(s)	189, 1169, 1778, 1913, 1981, 2218
ScrFI	CCNGG	3 cut(s)	453, 725, 2046
SduI	GDGCHC	2 cut(s)	96, 1522
SfaNI	GCATC	9 cut(s)	484, 648, 1275, 1300, 1373, 1384, 1530, 1762, 1886
SfcI	CTRYAG	1 cut(s)	687
SinI	GGWCC	1 cut(s)	1836
SmiMI	CAYNNNNRTG	4 cut(s)	464, 600, 1938, 2193
SmlI	CTYRAG	1 cut(s)	808
SmoI	CTYRAG	1 cut(s)	808
SpeI	ACTAGT	1 cut(s)	422
SseBI	AGGCCT	1 cut(s)	2044
SsiI	CCGC	5 cut(s)	914, 1164, 2131, 2160, 2298
SspI	AATATT	1 cut(s)	884
SspMI	CTAG	7 cut(s)	423, 662, 894, 1661, 1869, 2018, 2217
StuI	AGGCCT	1 cut(s)	2044
StyD4I	CCNGG	3 cut(s)	451, 723, 2044
StyI	CCWWGG	4 cut(s)	1432, 1638, 1737, 1839
TaaI	ACNGT	4 cut(s)	265, 389, 828, 2234
TaiI	ACGT	5 cut(s)	111, 613, 972, 1029, 1393
TaqI	TCGA	5 cut(s)	953, 1011, 1381, 1592, 2307
TatI	WGTACW	2 cut(s)	1752, 2262
TauI	GCSGC	1 cut(s)	2163
TfiI	GAWTC	9 cut(s)	116, 563, 627, 670, 781, 917, 1142, 1594, 1643
Tru1I	TTAA	4 cut(s)	203, 419, 809, 1461
Tru9I	TTAA	4 cut(s)	203, 419, 809, 1461
TscAI	CASTG	5 cut(s)	555, 831, 1044, 1894, 1966
TseFI	GTSAC	1 cut(s)	1049
Tsp45I	GTSAC	1 cut(s)	1049
TspGWI	ACGGA	4 cut(s)	69, 1475, 1863, 2272
TspRI	CASTG	5 cut(s)	555, 831, 1044, 1894, 1966
Vha464I	CTTAAG	1 cut(s)	808
VpaK11BI	GGWCC	1 cut(s)	1836
XapI	RAATTY	1 cut(s)	2009
XceI	RCATGY	3 cut(s)	1196, 1553, 2131
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1430
XmnI	GAANNNNTTC	1 cut(s)	1094
XspI	CTAG	7 cut(s)	423, 662, 894, 1661, 1869, 2018, 2217
Zsp2I	ATGCAT	3 cut(s)	499, 637, 1555

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.