Rmu_sc0004498.1_g000002

Removes the formyl group from the N-terminal Met of newly synthesized proteins

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004498.1
Physical Location & Seq
Reverse (-)
2487 .. 2802
316 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004498.1_g000002.1.cds

Sequence Viewer

Length: 249 bp
atgcagcttgaagaagaagaagaagaagaagaggggaaaagcttagggttcggcaaagatcaggaaaaagagatggccaaacaaggctcctcactcaaagaagatgacgtagcttctgctgctgatgttgaatttgagaagcctctgaaaattgtggagtatccagaccctattctgagagcaaagaaaaagagaattgaatcgtttgatgaaaatttgaagaaattatggaggaaatgtttgacataa

Protein Analysis

82

Amino Acids

9.52

Weight (kDa)

4.79

Isoelectric Point (pI)

61.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 75
AcsI RAATTY 2 cut(s) 131, 214
AgsI TTSAA 4 cut(s) 11, 131, 200, 220
AluBI AGCT 3 cut(s) 7, 42, 113
AluI AGCT 3 cut(s) 7, 42, 113
AoxI GGCC 1 cut(s) 75
ApeKI GCWGC 2 cut(s) 4, 119
ApoI RAATTY 2 cut(s) 131, 214
BalI TGGCCA 1 cut(s) 77
BbvI GCAGC 2 cut(s) 16, 106
BccI CCATC 1 cut(s) 67
BciVI GTATCC 1 cut(s) 171
BfuI GTATCC 1 cut(s) 171
BisI GCNGC 2 cut(s) 5, 120
BlsI GCNGC 2 cut(s) 6, 121
BmiI GGNNCC 1 cut(s) 88
Bpu10I CCTNAGC 1 cut(s) 43
BsaXI ACNNNNNCTCC 1 cut(s) 223
BseMII CTCAG 1 cut(s) 167
BseRI GAGGAG 1 cut(s) 79
BseXI GCAGC 2 cut(s) 16, 106
BshFI GGCC 1 cut(s) 77
BsnI GGCC 1 cut(s) 77
Bsp143I GATC 1 cut(s) 58
BspANI GGCC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 168
BspLI GGNNCC 1 cut(s) 88
BssMI GATC 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 24
BstDEI CTNAG 2 cut(s) 43, 176
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstV1I GCAGC 2 cut(s) 16, 106
BsuI GTATCC 1 cut(s) 171
BsuRI GGCC 1 cut(s) 77
CviJI RGCY 6 cut(s) 7, 42, 77, 87, 113, 142
CviKI_1 RGCY 6 cut(s) 7, 42, 77, 87, 113, 142
DdeI CTNAG 2 cut(s) 43, 176
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
EaeI YGGCCR 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
FaiI YATR 2 cut(s) 229, 247
Fnu4HI GCNGC 2 cut(s) 5, 120
Fsp4HI GCNGC 2 cut(s) 5, 120
GluI GCNGC 2 cut(s) 5, 120
HaeIII GGCC 1 cut(s) 77
HindIII AAGCTT 1 cut(s) 40
HinfI GANTC 1 cut(s) 200
Hpy188I TCNGA 2 cut(s) 147, 177
Hpy188III TCNNGA 2 cut(s) 62, 164
HpyCH4IV ACGT 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
HpyF3I CTNAG 2 cut(s) 43, 176
HpySE526I ACGT 1 cut(s) 108
Kzo9I GATC 1 cut(s) 58
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 2 cut(s) 47, 177
Lsp1109I GCAGC 2 cut(s) 16, 106
MaeII ACGT 1 cut(s) 108
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 9 cut(s) 23, 26, 29, 32, 35, 38, 41, 113, 232
MlsI TGGCCA 1 cut(s) 77
MluCI AATT 5 cut(s) 131, 150, 195, 214, 224
MluNI TGGCCA 1 cut(s) 77
MnlI CCTC 4 cut(s) 25, 100, 153, 225
Mox20I TGGCCA 1 cut(s) 77
MscI TGGCCA 1 cut(s) 77
Msp20I TGGCCA 1 cut(s) 77
MwoI GCNNNNNNNGC 1 cut(s) 119
NdeII GATC 1 cut(s) 58
NlaIV GGNNCC 1 cut(s) 88
PfeI GAWTC 1 cut(s) 200
PkrI GCNGC 2 cut(s) 6, 121
PspN4I GGNNCC 1 cut(s) 88
SatI GCNGC 2 cut(s) 5, 120
Sau3AI GATC 1 cut(s) 58
SetI ASST 4 cut(s) 9, 44, 111, 115
SgeI CNNG 4 cut(s) 20, 74, 95, 176
Sse9I AATT 5 cut(s) 131, 150, 195, 214, 224
TaiI ACGT 1 cut(s) 111
TasI AATT 5 cut(s) 131, 150, 195, 214, 224
TfiI GAWTC 1 cut(s) 200
TseI GCWGC 2 cut(s) 4, 119
TspDTI ATGAA 1 cut(s) 225
XapI RAATTY 2 cut(s) 131, 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.