Rh4BG378100

Removes the formyl group from the N-terminal Met of newly synthesized proteins

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
53320219 .. 53320474
256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG378100.1

Sequence Viewer

Length: 189 bp
ATGGCCAAACGAGGCTCTGCACTCAAAGAAGACGAAGTAGCTTCTGCTGCTGATGTTGAATTTGAGACGCCTCTGAAAATTGTGGAGTATTCGGACCCTATTCTGAGAGCAAAGAATAAGAGAATTGAATCGTTTGATGAAAATTTGAAGAAATTAGTGGAAGAAACGTTTGATATAATGTACAAATAA

Protein Analysis

62

Amino Acids

7.15

Weight (kDa)

4.9

Isoelectric Point (pI)

49.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 167
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 59, 142
AcyI GRCGYC 1 cut(s) 68
AfaI GTAC 1 cut(s) 182
AgsI TTSAA 3 cut(s) 59, 128, 148
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
Alw26I GTCTC 1 cut(s) 59
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 1 cut(s) 47
ApoI RAATTY 2 cut(s) 59, 142
AspS9I GGNCC 1 cut(s) 94
AvaII GGWCC 1 cut(s) 94
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 36
BbvI GCAGC 1 cut(s) 34
BcoDI GTCTC 1 cut(s) 59
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
BmiI GGNNCC 1 cut(s) 96
BpiI GAAGAC 1 cut(s) 36
BsaHI GRCGYC 1 cut(s) 68
BseMII CTCAG 1 cut(s) 95
BseXI GCAGC 1 cut(s) 34
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 59
BsmBI CGTCTC 1 cut(s) 59
BsnI GGCC 1 cut(s) 5
Bsp1407I TGTACA 1 cut(s) 180
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 96
BspLI GGNNCC 1 cut(s) 96
BsrGI TGTACA 1 cut(s) 180
BssNI GRCGYC 1 cut(s) 68
BstACI GRCGYC 1 cut(s) 68
BstAUI TGTACA 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 104
BstMAI GTCTC 1 cut(s) 59
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstV1I GCAGC 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 36
BsuRI GGCC 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 94
CseI GACGC 1 cut(s) 76
Csp6I GTAC 1 cut(s) 181
CviJI RGCY 3 cut(s) 5, 15, 41
CviKI_1 RGCY 3 cut(s) 5, 15, 41
CviQI GTAC 1 cut(s) 181
DdeI CTNAG 1 cut(s) 104
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 94
Esp3I CGTCTC 1 cut(s) 59
FaiI YATR 1 cut(s) 176
Fnu4HI GCNGC 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 48
FspEI CC 7 cut(s) 19, 68, 77, 84, 110, 111, 143
GluI GCNGC 1 cut(s) 48
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 76
Hin1I GRCGYC 1 cut(s) 68
HinfI GANTC 1 cut(s) 128
Hpy188I TCNGA 3 cut(s) 75, 94, 105
HpyCH4IV ACGT 1 cut(s) 167
HpyCH4V TGCA 1 cut(s) 20
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 104
HpySE526I ACGT 1 cut(s) 167
Hsp92I GRCGYC 1 cut(s) 68
Lsp1109I GCAGC 1 cut(s) 34
MaeII ACGT 1 cut(s) 167
MboII GAAGA 3 cut(s) 41, 160, 173
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 5 cut(s) 59, 78, 123, 142, 152
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 5, 81
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 47
NlaIV GGNNCC 1 cut(s) 96
PfeI GAWTC 1 cut(s) 128
PkrI GCNGC 1 cut(s) 49
Psp1406I AACGTT 1 cut(s) 167
PspN4I GGNNCC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 94
RsaI GTAC 1 cut(s) 182
RsaNI GTAC 1 cut(s) 181
SatI GCNGC 1 cut(s) 48
Sau96I GGNCC 1 cut(s) 94
SetI ASST 2 cut(s) 43, 170
SgeI CNNG 1 cut(s) 23
SinI GGWCC 1 cut(s) 94
Sse9I AATT 5 cut(s) 59, 78, 123, 142, 152
TaiI ACGT 1 cut(s) 170
TasI AATT 5 cut(s) 59, 78, 123, 142, 152
TatI WGTACW 1 cut(s) 180
TfiI GAWTC 1 cut(s) 128
TseI GCWGC 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 153
VpaK11BI GGWCC 1 cut(s) 94
XapI RAATTY 2 cut(s) 59, 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.