Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004528.1

Orthogroup ID

OG0005984

Physical Location & Seq

Genomic Coordinates Forward (+)

5605 .. 8625

Gene Structure 3021 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004528.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1215 bp

atgtcttggaaaagcagaggagacccttcttcttctagaagtgtaatttcacagaaatggacccttttgctttgtttaagctgcttctgtgctggaatgctcttcaccaataggatgtggagtgttccggaaagtagaggtctaacacggagaacagctttggaagaagcgaaattaaacttagtatcagagggttgcaatccaaaagctaaggaagtagagcgagaaactaaggacatttttggagaggtttataagactcataatgctatacagacactagataagactatttcaaatttagagatggaattagccgctgcaagggcaacacaagagtctatacgtagtggctctccttcatcaggtgactcgaagactgactcatctgggaagagaaggtatttaatggttgttggaatcaatactgcttttagcagccggaaaagaagagattcagttcgtgctacttggatgcctcaaggcgagaaaaggaagagactggaggaagagaagggtataattatccgttttgtcattggtcacagtgccacatcaggaggcattctagacagagcagttgaagccgaggacagaaagcacggagatctcctgaggctggaccacgttgaaggatatctggaattgtctgccaagacaaaaatatattttgctactgctgctgctatgtgggatgcagatttttatgtcaaagtcgacgatgatgtccacgtaaatattgcgacactaggagaaacattagttagacaccgaaagaaatcacgtctgtacattggatgcatgaaatctggtcctgttctggcacaaaagggagtgagataccatgaacctgaatattggaaatttggtgaacctggaaacaagtatttccgtcatgctacaggacaattatacgcaatctcaagagatttggctacatatatatcaataaaccagcatgtcctccacaagtatgcgaatgaggatgtctctttgggagcttggtttattggacttgatgtgcagcatatcgatgataggagactatgttgtggcaccccacctgattgtgagtggaaggcccaggcaggcaacgtctgcgttgcttcatttgattggagttgcagtggaatttgtaggtcagctgagaggattaaggaagtccatcgacgctgcggggaaggcgaaaacgctttatggagtgcttctttctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0012505 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4094 Galactosyl_T

Protein Analysis

404

Amino Acids

45.49

Weight (kDa)

8.89

Isoelectric Point (pI)

46.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005984)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G05170 AT1G05170 AT2G32430
fragaria_vesca	FvH4_6g43140 FvH4_6g43140 FvH4_6g43140 FvH4_6g43140 FvH4_6g43140 FvH4_6g43140
malus_domestica	MD09G1109300.v1.1 MD17G1097500.v1.1
prunus_persica	Prupe.3G216900_v2.0.a1 Prupe.3G216900_v2.0.a1 Prupe.3G216900_v2.0.a1
pyrus_communis	pycom09g03200 pycom17g09300
rosa_chinensis	RchiOBHm_Chr2g0159221
rosa_laevigata	RLG00000021144
rosa_multiflora	Rmu_sc0004528.1_g000001
rosa_roxburghii	Rroxscaffold_2G00090690
rosa_rugosa	Rorug02G0474800 Rorug02G0474900
rosa_samantha	Rh2AG541700 Rh2BG554300 Rh2CG524400 Rh2DG564100
rosa_wichuraiana	Rw2G044800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	255
AasI	GACNNNNNNGTC	1 cut(s)	725
AccB1I	GGYRCC	1 cut(s)	1055
AccI	GTMKAC	1 cut(s)	717
AccIII	TCCGGA	1 cut(s)	127
AciI	CCGC	2 cut(s)	318, 1176
AcsI	RAATTY	3 cut(s)	298, 863, 1131
AfaI	GTAC	1 cut(s)	791
AfiI	CCNNNNNNNGG	3 cut(s)	324, 365, 619
AgsI	TTSAA	3 cut(s)	297, 584, 632
AjiI	CACGTC	1 cut(s)	785
AjnI	CCWGG	2 cut(s)	874, 1083
AluBI	AGCT	5 cut(s)	81, 158, 209, 1001, 1145
AluI	AGCT	5 cut(s)	81, 158, 209, 1001, 1145
Alw26I	GTCTC	4 cut(s)	15, 493, 994, 1036
Aor13HI	TCCGGA	1 cut(s)	127
AoxI	GGCC	1 cut(s)	1080
ApeKI	GCWGC	7 cut(s)	81, 320, 438, 680, 683, 1024, 1173
ApoI	RAATTY	3 cut(s)	298, 863, 1131
Asp700I	GAANNNNTTC	1 cut(s)	454
AspS9I	GGNCC	4 cut(s)	60, 622, 812, 1081
AsuHPI	GGTGA	3 cut(s)	97, 380, 881
AvaII	GGWCC	3 cut(s)	60, 622, 812
AxyI	CCTNAGG	1 cut(s)	614
BanI	GGYRCC	1 cut(s)	1055
BbsI	GAAGAC	1 cut(s)	383
BbvI	GCAGC	7 cut(s)	68, 307, 450, 667, 670, 1036, 1160
BccI	CCATC	2 cut(s)	301, 1173
BciT130I	CCWGG	2 cut(s)	876, 1085
BcoDI	GTCTC	4 cut(s)	15, 493, 994, 1036
BfaI	CTAG	4 cut(s)	36, 281, 569, 749
BfmI	CTRYAG	1 cut(s)	900
BglII	AGATCT	1 cut(s)	607
BisI	GCNGC	8 cut(s)	82, 318, 321, 439, 681, 684, 1025, 1174
BlsI	GCNGC	8 cut(s)	83, 319, 322, 440, 682, 685, 1026, 1175
Bme1390I	CCNGG	2 cut(s)	876, 1085
Bme18I	GGWCC	3 cut(s)	60, 622, 812
BmgBI	CACGTC	1 cut(s)	785
BmgT120I	GGNCC	4 cut(s)	60, 622, 812, 1081
BmiI	GGNNCC	2 cut(s)	62, 1057
BmrFI	CCNGG	2 cut(s)	876, 1085
BmsI	GCATC	3 cut(s)	465, 685, 788
BpiI	GAAGAC	1 cut(s)	383
BplI	GAGNNNNNCTC	2 cut(s)	974, 1006
BpmI	CTGGAG	1 cut(s)	524
Bpu10I	CCTNAGC	1 cut(s)	210
BpuEI	CTTGAG	2 cut(s)	465, 907
Bsa29I	ATCGAT	1 cut(s)	1032
BsaAI	YACGTR	2 cut(s)	347, 733
BsaI	GGTCTC	1 cut(s)	15
BsaJI	CCNNGG	2 cut(s)	588, 1083
BsaWI	WCCGGW	1 cut(s)	127
BsaXI	ACNNNNNCTCC	4 cut(s)	1033, 1063, 1111, 1141
Bsc4I	CCNNNNNNNGG	3 cut(s)	324, 365, 619
Bse1I	ACTGG	1 cut(s)	507
Bse21I	CCTNAGG	1 cut(s)	614
BseAI	TCCGGA	1 cut(s)	127
BseBI	CCWGG	2 cut(s)	876, 1085
BseCI	ATCGAT	1 cut(s)	1032
BseDI	CCNNGG	2 cut(s)	588, 1083
BseGI	GGATG	5 cut(s)	120, 480, 700, 803, 991
BseLI	CCNNNNNNNGG	3 cut(s)	324, 365, 619
BseMII	CTCAG	2 cut(s)	605, 1137
BseNI	ACTGG	1 cut(s)	507
BseRI	GAGGAG	1 cut(s)	33
BseXI	GCAGC	7 cut(s)	68, 307, 450, 667, 670, 1036, 1160
BsgI	GTGCAG	1 cut(s)	1043
BshFI	GGCC	1 cut(s)	1082
BshNI	GGYRCC	1 cut(s)	1055
BshVI	ATCGAT	1 cut(s)	1032
BsiSI	CCGG	2 cut(s)	128, 442
BslI	CCNNNNNNNGG	3 cut(s)	324, 365, 619
BsmAI	GTCTC	4 cut(s)	15, 493, 994, 1036
BsmI	GAATGC	2 cut(s)	102, 564
BsnI	GGCC	1 cut(s)	1082
Bso31I	GGTCTC	1 cut(s)	15
Bsp13I	TCCGGA	1 cut(s)	127
Bsp1407I	TGTACA	1 cut(s)	789
Bsp143I	GATC	1 cut(s)	607
BspACI	CCGC	2 cut(s)	318, 1176
BspANI	GGCC	1 cut(s)	1082
BspCNI	CTCAG	2 cut(s)	606, 1138
BspDI	ATCGAT	1 cut(s)	1032
BspEI	TCCGGA	1 cut(s)	127
BspLI	GGNNCC	2 cut(s)	62, 1057
BspQI	GCTCTTC	1 cut(s)	107
BspT107I	GGYRCC	1 cut(s)	1055
BspTNI	GGTCTC	1 cut(s)	15
BsrGI	TGTACA	1 cut(s)	789
BsrI	ACTGG	1 cut(s)	507
BssECI	CCNNGG	2 cut(s)	588, 1083
BssMI	GATC	1 cut(s)	607
Bst2UI	CCWGG	2 cut(s)	876, 1085
Bst4CI	ACNGT	1 cut(s)	548
Bst6I	CTCTTC	5 cut(s)	107, 389, 445, 491, 504
BstAPI	GCANNNNNTGC	1 cut(s)	1098
BstAUI	TGTACA	1 cut(s)	789
BstBAI	YACGTR	2 cut(s)	347, 733
BstC8I	GCNNGC	1 cut(s)	1090
BstDEI	CTNAG	5 cut(s)	181, 210, 231, 614, 1146
BstENI	CCTNNNNNAGG	1 cut(s)	363
BstF5I	GGATG	5 cut(s)	120, 480, 700, 803, 991
BstKTI	GATC	1 cut(s)	610
BstMAI	GTCTC	4 cut(s)	15, 493, 994, 1036
BstMBI	GATC	1 cut(s)	607
BstMWI	GCNNNNNNNGC	5 cut(s)	326, 584, 680, 1098, 1182
BstNI	CCWGG	2 cut(s)	876, 1085
BstNSI	RCATGY	1 cut(s)	962
BstSCI	CCNGG	2 cut(s)	874, 1083
BstSFI	CTRYAG	1 cut(s)	900
BstSNI	TACGTA	1 cut(s)	347
BstV1I	GCAGC	7 cut(s)	68, 307, 450, 667, 670, 1036, 1160
BstV2I	GAAGAC	1 cut(s)	383
BstX2I	RGATCY	1 cut(s)	607
BstYI	RGATCY	1 cut(s)	607
Bsu15I	ATCGAT	1 cut(s)	1032
Bsu36I	CCTNAGG	1 cut(s)	614
BsuRI	GGCC	1 cut(s)	1082
BsuTUI	ATCGAT	1 cut(s)	1032
BtrI	CACGTC	1 cut(s)	785
BtsCI	GGATG	5 cut(s)	120, 480, 700, 803, 991
BtsI	GCAGTG	1 cut(s)	1132
BtsIMutI	CAGTG	2 cut(s)	553, 1132
Cac8I	GCNNGC	1 cut(s)	1090
Cfr13I	GGNCC	4 cut(s)	60, 622, 812, 1081
ClaI	ATCGAT	1 cut(s)	1032
CseI	GACGC	1 cut(s)	1179
Csp6I	GTAC	1 cut(s)	790
CviAII	CATG	4 cut(s)	802, 845, 896, 959
CviQI	GTAC	1 cut(s)	790
DdeI	CTNAG	5 cut(s)	181, 210, 231, 614, 1146
DpnI	GATC	1 cut(s)	609
DpnII	GATC	1 cut(s)	607
DrdI	GACNNNNNNGTC	1 cut(s)	725
DseDI	GACNNNNNNGTC	1 cut(s)	725
Eam1104I	CTCTTC	5 cut(s)	107, 389, 445, 491, 504
EarI	CTCTTC	5 cut(s)	107, 389, 445, 491, 504
Eco105I	TACGTA	1 cut(s)	347
Eco31I	GGTCTC	1 cut(s)	15
Eco32I	GATATC	1 cut(s)	638
Eco47I	GGWCC	3 cut(s)	60, 622, 812
Eco81I	CCTNAGG	1 cut(s)	614
EcoNI	CCTNNNNNAGG	1 cut(s)	363
EcoRII	CCWGG	2 cut(s)	874, 1083
EcoRV	GATATC	1 cut(s)	638
EcoT22I	ATGCAT	1 cut(s)	803
FaeI	CATG	4 cut(s)	805, 848, 899, 962
FatI	CATG	4 cut(s)	801, 844, 895, 958
FauI	CCCGC	1 cut(s)	1169
FblI	GTMKAC	1 cut(s)	717
Fnu4HI	GCNGC	8 cut(s)	82, 318, 321, 439, 681, 684, 1025, 1174
FokI	GGATG	5 cut(s)	127, 487, 707, 810, 998
Fsp4HI	GCNGC	8 cut(s)	82, 318, 321, 439, 681, 684, 1025, 1174
FspBI	CTAG	4 cut(s)	36, 281, 569, 749
GluI	GCNGC	8 cut(s)	82, 318, 321, 439, 681, 684, 1025, 1174
GsuI	CTGGAG	1 cut(s)	524
HaeIII	GGCC	1 cut(s)	1082
HapII	CCGG	2 cut(s)	128, 442
HgaI	GACGC	1 cut(s)	1179
Hin1II	CATG	4 cut(s)	805, 848, 899, 962
HincII	GTYRAC	1 cut(s)	718
HindII	GTYRAC	1 cut(s)	718
HinfI	GANTC	6 cut(s)	259, 338, 371, 383, 420, 455
HpaII	CCGG	2 cut(s)	128, 442
HphI	GGTGA	3 cut(s)	97, 380, 881
Hpy166II	GTNNAC	3 cut(s)	718, 730, 872
Hpy188I	TCNGA	1 cut(s)	190
Hpy188III	TCNNGA	7 cut(s)	36, 128, 558, 569, 613, 641, 924
Hpy8I	GTNNAC	3 cut(s)	718, 730, 872
Hpy99I	CGWCG	2 cut(s)	722, 1173
HpyAV	CCTTC	7 cut(s)	36, 369, 393, 508, 626, 1072, 1175
HpyCH4III	ACNGT	1 cut(s)	548
HpyCH4IV	ACGT	5 cut(s)	346, 627, 732, 784, 1095
HpyCH4V	TGCA	6 cut(s)	198, 323, 698, 801, 1024, 1125
HpyF10VI	GCNNNNNNNGC	5 cut(s)	326, 584, 680, 1098, 1182
HpyF3I	CTNAG	5 cut(s)	181, 210, 231, 614, 1146
HpySE526I	ACGT	5 cut(s)	346, 627, 732, 784, 1095
Hsp92II	CATG	4 cut(s)	805, 848, 899, 962
Kpn2I	TCCGGA	1 cut(s)	127
Kzo9I	GATC	1 cut(s)	607
LguI	GCTCTTC	1 cut(s)	107
LmnI	GCTCC	1 cut(s)	998
Lsp1109I	GCAGC	7 cut(s)	68, 307, 450, 667, 670, 1036, 1160
LweI	GCATC	3 cut(s)	465, 685, 788
MaeI	CTAG	4 cut(s)	36, 281, 569, 749
MaeII	ACGT	5 cut(s)	346, 627, 732, 784, 1095
MaeIII	GTNAC	2 cut(s)	368, 542
MalI	GATC	1 cut(s)	609
MboI	GATC	1 cut(s)	607
MboII	GAAGA	9 cut(s)	21, 24, 94, 176, 388, 406, 462, 508, 521
MflI	RGATCY	1 cut(s)	607
MluCI	AATT	9 cut(s)	45, 173, 298, 311, 522, 644, 863, 908, 1131
MlyI	GAGTC	4 cut(s)	253, 347, 365, 377
MmeI	TCCRAC	1 cut(s)	397
Mph1103I	ATGCAT	1 cut(s)	803
MroI	TCCGGA	1 cut(s)	127
MroXI	GAANNNNTTC	1 cut(s)	454
MseI	TTAA	4 cut(s)	77, 176, 407, 1155
MslI	CAYNNNNRTG	3 cut(s)	55, 972, 1032
MspA1I	CMGCKG	2 cut(s)	320, 1145
MspI	CCGG	2 cut(s)	128, 442
MspR9I	CCNGG	2 cut(s)	876, 1085
Mva1269I	GAATGC	2 cut(s)	102, 564
MvaI	CCWGG	2 cut(s)	876, 1085
MwoI	GCNNNNNNNGC	5 cut(s)	326, 584, 680, 1098, 1182
NdeII	GATC	1 cut(s)	607
NlaIII	CATG	4 cut(s)	805, 848, 899, 962
NlaIV	GGNNCC	2 cut(s)	62, 1057
NmeAIII	GCCGAG	1 cut(s)	613
NmuCI	GTSAC	2 cut(s)	368, 542
NsiI	ATGCAT	1 cut(s)	803
NspI	RCATGY	1 cut(s)	962
PciSI	GCTCTTC	1 cut(s)	107
PctI	GAATGC	2 cut(s)	102, 564
PdmI	GAANNNNTTC	1 cut(s)	454
PfeI	GAWTC	2 cut(s)	420, 455
PkrI	GCNGC	8 cut(s)	83, 319, 322, 440, 682, 685, 1026, 1175
PleI	GAGTC	4 cut(s)	253, 346, 365, 377
PpsI	GAGTC	4 cut(s)	253, 346, 365, 377
Ppu21I	YACGTR	2 cut(s)	347, 733
PsiI	TTATAA	1 cut(s)	255
Psp6I	CCWGG	2 cut(s)	874, 1083
PspGI	CCWGG	2 cut(s)	874, 1083
PspN4I	GGNNCC	2 cut(s)	62, 1057
PspPI	GGNCC	4 cut(s)	60, 622, 812, 1081
PsuI	RGATCY	1 cut(s)	607
PvuII	CAGCTG	1 cut(s)	1145
RsaI	GTAC	1 cut(s)	791
RsaNI	GTAC	1 cut(s)	790
RseI	CAYNNNNRTG	3 cut(s)	55, 972, 1032
SalI	GTCGAC	1 cut(s)	716
SapI	GCTCTTC	1 cut(s)	107
SaqAI	TTAA	4 cut(s)	77, 176, 407, 1155
SatI	GCNGC	8 cut(s)	82, 318, 321, 439, 681, 684, 1025, 1174
Sau3AI	GATC	1 cut(s)	607
Sau96I	GGNCC	4 cut(s)	60, 622, 812, 1081
SchI	GAGTC	4 cut(s)	253, 347, 365, 377
ScrFI	CCNGG	2 cut(s)	876, 1085
SfaNI	GCATC	3 cut(s)	465, 685, 788
SfcI	CTRYAG	1 cut(s)	900
SinI	GGWCC	3 cut(s)	60, 622, 812
SmiMI	CAYNNNNRTG	3 cut(s)	55, 972, 1032
SmlI	CTYRAG	2 cut(s)	480, 922
SmoI	CTYRAG	2 cut(s)	480, 922
SnaBI	TACGTA	1 cut(s)	347
Sse9I	AATT	9 cut(s)	45, 173, 298, 311, 522, 644, 863, 908, 1131
SsiI	CCGC	2 cut(s)	318, 1176
SspI	AATATT	2 cut(s)	739, 857
SspMI	CTAG	4 cut(s)	36, 281, 569, 749
StyD4I	CCNGG	2 cut(s)	874, 1083
TaaI	ACNGT	1 cut(s)	548
TaiI	ACGT	5 cut(s)	349, 630, 735, 787, 1098
TaqI	TCGA	4 cut(s)	374, 717, 1032, 1168
TasI	AATT	9 cut(s)	45, 173, 298, 311, 522, 644, 863, 908, 1131
TatI	WGTACW	1 cut(s)	789
TauI	GCSGC	1 cut(s)	320
TfiI	GAWTC	2 cut(s)	420, 455
Tru1I	TTAA	4 cut(s)	77, 176, 407, 1155
Tru9I	TTAA	4 cut(s)	77, 176, 407, 1155
TscAI	CASTG	2 cut(s)	553, 1132
TseFI	GTSAC	2 cut(s)	368, 542
TseI	GCWGC	7 cut(s)	81, 320, 438, 680, 683, 1024, 1173
Tsp45I	GTSAC	2 cut(s)	368, 542
TspDTI	ATGAA	4 cut(s)	351, 818, 861, 1098
TspGWI	ACGGA	4 cut(s)	163, 518, 618, 881
TspRI	CASTG	2 cut(s)	553, 1132
VpaK11BI	GGWCC	3 cut(s)	60, 622, 812
XagI	CCTNNNNNAGG	1 cut(s)	363
XapI	RAATTY	3 cut(s)	298, 863, 1131
XbaI	TCTAGA	2 cut(s)	35, 568
XceI	RCATGY	1 cut(s)	962
XmiI	GTMKAC	1 cut(s)	717
XmnI	GAANNNNTTC	1 cut(s)	454
XspI	CTAG	4 cut(s)	36, 281, 569, 749
Zsp2I	ATGCAT	1 cut(s)	803

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.