Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005120.1

Orthogroup ID

OG0006480

Physical Location & Seq

Genomic Coordinates Forward (+)

12384 .. 14862

Gene Structure 2479 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005120.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1062 bp

ctgcctttcactcaaacccaaagggggatggcagccggagaagaggctaacttgtcaaccttgaagtctcaactgagcctaacacatgaaatgtggaagctggagatggagcagagtcagtcctacgtggaggtattgcaaaagaagcttatagaggtagaggcttgtatagaggggtctgatgaagactcaaaaaaggaattagaggttctttggcggagagttaagacggctgccagtttgttaacatacttgaaatcaaaagcaagaataatggctgttcctcatttagcccatacagcatgtggcatcaaacaatctgaaggagtggggcttgttgataaaaatggtacaccgttggctggatggtctcggaatgttgatctttcttcctttgaaattccagatgaagattcttcaattgggattggcaagcaactggactctctagatgaacaagatgcagcttatatcagtgaactgcttaagtctgtgcagatggttacagatgtaatggaagctctagttaagagagttatattggcagaatctgaaacggcagttgagaaggagaaggtaacttttggtcaggaagaaattaagaagaagtccatccaaattgagaacatgtctttgaagttggaggagatggagcggtttgctctaggtacaaatggtattctaaatgaaatgcggcaaagagttgaggatttggttcaagagacatctatacagagggaacgagccacagaaaatgaacaggagctttgccgggtgaagcgggactttgagtctctaaaatcgtatgtcagcagtctcatcactgtacgagaaacattgctttcatcagagaagcagtttcaaactattgagaggctgtttgagcggctagttgcaaaaacaacacagttagagggtgagaaaacacagaaagaggtggaagttcaaaaacttatggaagagaatgtgaggctgagtgctcttcttgataagaaagaagctcaacttcatgccatgaatgaacaatgcaaggtgatggctttgagtgcttcgaacatctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

353

Amino Acids

39.95

Weight (kDa)

5.07

Isoelectric Point (pI)

44.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006480)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G17990 AT2G17990 AT2G17990
fragaria_vesca	FvH4_1g11960 FvH4_1g11960
malus_domestica	MD02G1133400.v1.1 MD15G1246600.v1.1
prunus_persica	Prupe.7G167200_v2.0.a1 Prupe.7G167200_v2.0.a1
pyrus_communis	pycom02g10510 pycom02g10520 pycom15g21700
rosa_chinensis	RchiOBHm_Chr2g0099581
rosa_laevigata	RLG00000016893
rosa_multiflora	Rmu_co8434585.1_g000001 Rmu_sc0005120.1_g000004
rosa_roxburghii	Rroxscaffold_2G00142960
rosa_rugosa	Rorug02G0080800 Rorug02G0080900 Rorug02G0081000 Rorug02G0081100
rosa_samantha	Rh2AG130700 Rh2BG133800 Rh2CG134600 Rh2DG135000
rosa_wichuraiana	Rw2G010090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	2 cut(s)	655, 886
AciI	CCGC	5 cut(s)	217, 655, 694, 781, 886
AcsI	RAATTY	1 cut(s)	399
AcuI	CTGAAG	1 cut(s)	342
AfaI	GTAC	3 cut(s)	352, 670, 828
AfiI	CCNNNNNNNGG	2 cut(s)	24, 362
AflII	CTTAAG	1 cut(s)	485
AflIII	ACRYGT	1 cut(s)	627
AgsI	TTSAA	8 cut(s)	64, 256, 398, 420, 637, 719, 863, 947
AhdI	GACNNNNNGTC	1 cut(s)	790
AluBI	AGCT	6 cut(s)	100, 148, 467, 521, 766, 1001
AluI	AGCT	6 cut(s)	100, 148, 467, 521, 766, 1001
Alw21I	GWGCWC	1 cut(s)	982
Alw26I	GTCTC	5 cut(s)	72, 375, 716, 798, 821
AlwNI	CAGNNNCTG	1 cut(s)	551
ApeKI	GCWGC	3 cut(s)	32, 233, 464
ApoI	RAATTY	1 cut(s)	399
AsuC2I	CCSGG	1 cut(s)	773
AsuHPI	GGTGA	3 cut(s)	787, 929, 1045
AsuII	TTCGAA	1 cut(s)	1052
BbsI	GAAGAC	1 cut(s)	192
Bbv12I	GWGCWC	1 cut(s)	982
BbvI	GCAGC	3 cut(s)	44, 220, 476
BccI	CCATC	7 cut(s)	22, 100, 360, 493, 620, 643, 1030
BceAI	ACGGC	2 cut(s)	246, 573
BcnI	CCSGG	1 cut(s)	773
BcoDI	GTCTC	5 cut(s)	72, 375, 716, 798, 821
BfaI	CTAG	4 cut(s)	449, 524, 665, 890
BfrI	CTTAAG	1 cut(s)	485
BisI	GCNGC	5 cut(s)	33, 234, 465, 695, 887
BlsI	GCNGC	5 cut(s)	34, 235, 466, 696, 888
Bme1390I	CCNGG	1 cut(s)	773
BmeRI	GACNNNNNGTC	1 cut(s)	790
BmrFI	CCNGG	1 cut(s)	773
BmsI	GCATC	2 cut(s)	318, 451
BpiI	GAAGAC	1 cut(s)	192
BpmI	CTGGAG	1 cut(s)	122
Bpu14I	TTCGAA	1 cut(s)	1052
BpuMI	CCSGG	1 cut(s)	773
BsaAI	YACGTR	1 cut(s)	127
BsaI	GGTCTC	1 cut(s)	375
Bsc4I	CCNNNNNNNGG	2 cut(s)	24, 362
Bse1I	ACTGG	2 cut(s)	237, 444
Bse3DI	GCAATG	1 cut(s)	836
BseGI	GGATG	3 cut(s)	33, 371, 612
BseLI	CCNNNNNNNGG	2 cut(s)	24, 362
BseMI	GCAATG	1 cut(s)	836
BseMII	CTCAG	2 cut(s)	65, 965
BseNI	ACTGG	2 cut(s)	237, 444
BseRI	GAGGAG	1 cut(s)	659
BseXI	GCAGC	3 cut(s)	44, 220, 476
BsgI	GTGCAG	1 cut(s)	515
BsiHKAI	GWGCWC	1 cut(s)	982
BsiSI	CCGG	2 cut(s)	36, 772
BslFI	GGGAC	1 cut(s)	797
BslI	CCNNNNNNNGG	2 cut(s)	24, 362
BsmAI	GTCTC	5 cut(s)	72, 375, 716, 798, 821
BsmFI	GGGAC	1 cut(s)	797
Bso31I	GGTCTC	1 cut(s)	375
Bsp119I	TTCGAA	1 cut(s)	1052
Bsp1286I	GDGCHC	1 cut(s)	982
Bsp143I	GATC	1 cut(s)	382
BspACI	CCGC	5 cut(s)	217, 655, 694, 781, 886
BspCNI	CTCAG	2 cut(s)	66, 966
BspQI	GCTCTTC	1 cut(s)	987
BspT104I	TTCGAA	1 cut(s)	1052
BspTI	CTTAAG	1 cut(s)	485
BspTNI	GGTCTC	1 cut(s)	375
BsrBI	CCGCTC	2 cut(s)	655, 886
BsrDI	GCAATG	1 cut(s)	836
BsrI	ACTGG	2 cut(s)	237, 444
BssMI	GATC	1 cut(s)	382
Bst4CI	ACNGT	3 cut(s)	357, 826, 909
Bst6I	CTCTTC	3 cut(s)	36, 954, 987
BstAFI	CTTAAG	1 cut(s)	485
BstBAI	YACGTR	1 cut(s)	127
BstBI	TTCGAA	1 cut(s)	1052
BstC8I	GCNNGC	1 cut(s)	434
BstDEI	CTNAG	2 cut(s)	74, 974
BstF5I	GGATG	3 cut(s)	33, 371, 612
BstKTI	GATC	1 cut(s)	385
BstMAI	GTCTC	5 cut(s)	72, 375, 716, 798, 821
BstMBI	GATC	1 cut(s)	382
BstMWI	GCNNNNNNNGC	4 cut(s)	145, 299, 883, 1046
BstNSI	RCATGY	2 cut(s)	306, 631
BstSCI	CCNGG	1 cut(s)	771
BstV1I	GCAGC	3 cut(s)	44, 220, 476
BstV2I	GAAGAC	1 cut(s)	192
BtsCI	GGATG	3 cut(s)	33, 371, 612
BtsIMutI	CAGTG	2 cut(s)	481, 822
Cac8I	GCNNGC	1 cut(s)	434
CaiI	CAGNNNCTG	1 cut(s)	551
Csp6I	GTAC	3 cut(s)	351, 669, 827
CviAII	CATG	5 cut(s)	86, 303, 628, 1010, 1015
CviQI	GTAC	3 cut(s)	351, 669, 827
DdeI	CTNAG	2 cut(s)	74, 974
DpnI	GATC	1 cut(s)	384
DpnII	GATC	1 cut(s)	382
DriI	GACNNNNNGTC	1 cut(s)	790
Eam1104I	CTCTTC	3 cut(s)	36, 954, 987
Eam1105I	GACNNNNNGTC	1 cut(s)	790
EarI	CTCTTC	3 cut(s)	36, 954, 987
EciI	GGCGGA	1 cut(s)	232
Eco31I	GGTCTC	1 cut(s)	375
Eco57I	CTGAAG	1 cut(s)	342
FaeI	CATG	5 cut(s)	89, 306, 631, 1013, 1018
FalI	AAGNNNNNCTT	4 cut(s)	770, 802, 990, 1022
FaqI	GGGAC	1 cut(s)	797
FatI	CATG	5 cut(s)	85, 302, 627, 1009, 1014
FauI	CCCGC	1 cut(s)	774
Fnu4HI	GCNGC	5 cut(s)	33, 234, 465, 695, 887
FokI	GGATG	3 cut(s)	40, 378, 599
Fsp4HI	GCNGC	5 cut(s)	33, 234, 465, 695, 887
FspBI	CTAG	4 cut(s)	449, 524, 665, 890
GluI	GCNGC	5 cut(s)	33, 234, 465, 695, 887
GsuI	CTGGAG	1 cut(s)	122
HapII	CCGG	2 cut(s)	36, 772
Hin1II	CATG	5 cut(s)	89, 306, 631, 1013, 1018
HincII	GTYRAC	2 cut(s)	57, 246
HindII	GTYRAC	2 cut(s)	57, 246
HindIII	AAGCTT	1 cut(s)	146
HinfI	GANTC	6 cut(s)	115, 188, 413, 443, 548, 791
HpaI	GTTAAC	1 cut(s)	246
HpaII	CCGG	2 cut(s)	36, 772
HphI	GGTGA	3 cut(s)	787, 929, 1045
Hpy166II	GTNNAC	4 cut(s)	57, 246, 353, 479
Hpy188I	TCNGA	5 cut(s)	181, 322, 375, 553, 850
Hpy188III	TCNNGA	5 cut(s)	404, 449, 590, 719, 986
Hpy8I	GTNNAC	4 cut(s)	57, 246, 353, 479
HpyAV	CCTTC	3 cut(s)	317, 562, 568
HpyCH4III	ACNGT	3 cut(s)	357, 826, 909
HpyCH4IV	ACGT	1 cut(s)	126
HpyCH4V	TGCA	5 cut(s)	139, 464, 496, 896, 1029
HpyF10VI	GCNNNNNNNGC	4 cut(s)	145, 299, 883, 1046
HpyF3I	CTNAG	2 cut(s)	74, 974
HpySE526I	ACGT	1 cut(s)	126
Hsp92II	CATG	5 cut(s)	89, 306, 631, 1013, 1018
KspAI	GTTAAC	1 cut(s)	246
Kzo9I	GATC	1 cut(s)	382
LguI	GCTCTTC	1 cut(s)	987
LmnI	GCTCC	3 cut(s)	109, 652, 763
LpnPI	CCDG	9 cut(s)	49, 86, 250, 348, 417, 425, 575, 746, 785
Lsp1109I	GCAGC	3 cut(s)	44, 220, 476
LweI	GCATC	2 cut(s)	318, 451
MaeI	CTAG	4 cut(s)	449, 524, 665, 890
MaeII	ACGT	1 cut(s)	126
MaeIII	GTNAC	2 cut(s)	502, 577
MalI	GATC	1 cut(s)	384
MbiI	CCGCTC	2 cut(s)	655, 886
MboI	GATC	1 cut(s)	382
MboII	GAAGA	9 cut(s)	53, 197, 381, 408, 422, 605, 616, 971, 974
MfeI	CAATTG	1 cut(s)	420
MhlI	GDGCHC	1 cut(s)	982
MluCI	AATT	5 cut(s)	200, 399, 420, 597, 618
MlyI	GAGTC	4 cut(s)	124, 182, 437, 800
MmeI	TCCRAC	1 cut(s)	621
MseI	TTAA	5 cut(s)	225, 245, 486, 528, 600
MspCI	CTTAAG	1 cut(s)	485
MspI	CCGG	2 cut(s)	36, 772
MspR9I	CCNGG	1 cut(s)	773
MunI	CAATTG	1 cut(s)	420
MwoI	GCNNNNNNNGC	4 cut(s)	145, 299, 883, 1046
NciI	CCSGG	1 cut(s)	773
NdeII	GATC	1 cut(s)	382
NlaIII	CATG	5 cut(s)	89, 306, 631, 1013, 1018
NspI	RCATGY	2 cut(s)	306, 631
NspV	TTCGAA	1 cut(s)	1052
PciI	ACATGT	1 cut(s)	627
PciSI	GCTCTTC	1 cut(s)	987
PfeI	GAWTC	2 cut(s)	413, 548
PkrI	GCNGC	5 cut(s)	34, 235, 466, 696, 888
PleI	GAGTC	4 cut(s)	123, 182, 437, 799
PpsI	GAGTC	4 cut(s)	123, 182, 437, 799
Ppu21I	YACGTR	1 cut(s)	127
PscI	ACATGT	1 cut(s)	627
PstNI	CAGNNNCTG	1 cut(s)	551
RsaI	GTAC	3 cut(s)	352, 670, 828
RsaNI	GTAC	3 cut(s)	351, 669, 827
SapI	GCTCTTC	1 cut(s)	987
SaqAI	TTAA	5 cut(s)	225, 245, 486, 528, 600
SatI	GCNGC	5 cut(s)	33, 234, 465, 695, 887
Sau3AI	GATC	1 cut(s)	382
SchI	GAGTC	4 cut(s)	124, 182, 437, 800
ScrFI	CCNGG	1 cut(s)	773
SduI	GDGCHC	1 cut(s)	982
SfaNI	GCATC	2 cut(s)	318, 451
SfuI	TTCGAA	1 cut(s)	1052
SmlI	CTYRAG	1 cut(s)	485
SmoI	CTYRAG	1 cut(s)	485
Sse9I	AATT	5 cut(s)	200, 399, 420, 597, 618
SsiI	CCGC	5 cut(s)	217, 655, 694, 781, 886
SspMI	CTAG	4 cut(s)	449, 524, 665, 890
StyD4I	CCNGG	1 cut(s)	771
TaaI	ACNGT	3 cut(s)	357, 826, 909
TaiI	ACGT	1 cut(s)	129
TaqI	TCGA	1 cut(s)	1052
TasI	AATT	5 cut(s)	200, 399, 420, 597, 618
TauI	GCSGC	2 cut(s)	697, 889
TfiI	GAWTC	2 cut(s)	413, 548
Tru1I	TTAA	5 cut(s)	225, 245, 486, 528, 600
Tru9I	TTAA	5 cut(s)	225, 245, 486, 528, 600
TscAI	CASTG	2 cut(s)	481, 829
TseI	GCWGC	3 cut(s)	32, 233, 464
TspRI	CASTG	2 cut(s)	481, 829
Vha464I	CTTAAG	1 cut(s)	485
XapI	RAATTY	1 cut(s)	399
XbaI	TCTAGA	1 cut(s)	448
XceI	RCATGY	2 cut(s)	306, 631
XcmI	CCANNNNNNNNNTGG	1 cut(s)	302
XspI	CTAG	4 cut(s)	449, 524, 665, 890

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.