Rmu_sc0005255.1_g000015

WLM domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005255.1
Physical Location & Seq
Forward (+)
68549 .. 68926
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005255.1_g000015.1.cds

Sequence Viewer

Length: 378 bp
atgcaaaagccaccagttggctctgaacctcttttgaagaaggcttatgaagaacccgatcctgatgcctctatgtcaaacggcattattcagccagtatctagatctaatgataatttggtgcttccaaatgaaatgcccaatatgcagatcgatgaaccaaatccagatgatcaagaaattcaaataattcaagaccctgtttcagttgcttgtaaacgtatgcagaagaccattgagatgttgcaagctgaagttaatcccacacaagctaccacagtcctcgaaactctgtttaacataataaggaatgttcctaaacacccaggtgaattgaaaaaaagaagactgcgcaaggctaagaatgtcgcaaactag

Protein Analysis

125

Amino Acids

14.07

Weight (kDa)

5.85

Isoelectric Point (pI)

61.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 353
AccB7I CCANNNNNTGG 1 cut(s) 17
AclWI GGATC 1 cut(s) 53
AcsI RAATTY 1 cut(s) 180
AcuI CTGAAG 1 cut(s) 273
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 4 cut(s) 37, 185, 194, 337
AjnI CCWGG 1 cut(s) 325
AleI CACNNNNGTG 1 cut(s) 327
AluBI AGCT 2 cut(s) 251, 272
AluI AGCT 2 cut(s) 251, 272
AlwI GGATC 1 cut(s) 53
ApoI RAATTY 1 cut(s) 180
AspLEI GCGC 1 cut(s) 354
AsuHPI GGTGA 1 cut(s) 341
BbsI GAAGAC 2 cut(s) 236, 352
BceAI ACGGC 1 cut(s) 97
BcgI CGANNNNNNTGC 2 cut(s) 47, 81
BciT130I CCWGG 1 cut(s) 327
BclI TGATCA 1 cut(s) 172
BfaI CTAG 2 cut(s) 102, 376
BglII AGATCT 1 cut(s) 104
Bme1390I CCNGG 1 cut(s) 327
BmrFI CCNGG 1 cut(s) 327
BmsI GCATC 1 cut(s) 55
BpiI GAAGAC 2 cut(s) 236, 352
Bsa29I ATCGAT 1 cut(s) 153
BsaJI CCNNGG 1 cut(s) 325
Bsc4I CCNNNNNNNGG 1 cut(s) 17
Bse1I ACTGG 2 cut(s) 14, 95
BseBI CCWGG 1 cut(s) 327
BseCI ATCGAT 1 cut(s) 153
BseDI CCNNGG 1 cut(s) 325
BseLI CCNNNNNNNGG 1 cut(s) 17
BseNI ACTGG 2 cut(s) 14, 95
BshVI ATCGAT 1 cut(s) 153
BslI CCNNNNNNNGG 1 cut(s) 17
Bsp143I GATC 4 cut(s) 58, 104, 150, 172
BspDI ATCGAT 1 cut(s) 153
BspPI GGATC 1 cut(s) 53
BsrI ACTGG 2 cut(s) 14, 95
BssECI CCNNGG 1 cut(s) 325
BssMI GATC 4 cut(s) 58, 104, 150, 172
Bst2UI CCWGG 1 cut(s) 327
Bst4CI ACNGT 1 cut(s) 280
BstC8I GCNNGC 1 cut(s) 249
BstDEI CTNAG 1 cut(s) 360
BstHHI GCGC 1 cut(s) 354
BstKTI GATC 4 cut(s) 61, 107, 153, 175
BstMBI GATC 4 cut(s) 58, 104, 150, 172
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 327
BstSCI CCNGG 1 cut(s) 325
BstV2I GAAGAC 2 cut(s) 236, 352
BstX2I RGATCY 1 cut(s) 104
BstYI RGATCY 1 cut(s) 104
Bsu15I ATCGAT 1 cut(s) 153
BsuTUI ATCGAT 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 249
CfoI GCGC 1 cut(s) 354
ClaI ATCGAT 1 cut(s) 153
CviJI RGCY 7 cut(s) 10, 21, 44, 94, 251, 272, 359
CviKI_1 RGCY 7 cut(s) 10, 21, 44, 94, 251, 272, 359
DdeI CTNAG 1 cut(s) 360
DpnI GATC 4 cut(s) 60, 106, 152, 174
DpnII GATC 4 cut(s) 58, 104, 150, 172
Eco57I CTGAAG 1 cut(s) 273
EcoRII CCWGG 1 cut(s) 325
FaiI YATR 5 cut(s) 48, 74, 146, 224, 302
FbaI TGATCA 1 cut(s) 172
FspBI CTAG 2 cut(s) 102, 376
FspI TGCGCA 1 cut(s) 353
GlaI GCGC 1 cut(s) 353
HhaI GCGC 1 cut(s) 354
Hin6I GCGC 1 cut(s) 352
HinP1I GCGC 1 cut(s) 352
HphI GGTGA 1 cut(s) 341
Hpy166II GTNNAC 1 cut(s) 218
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 5 cut(s) 62, 102, 167, 176, 194
Hpy8I GTNNAC 1 cut(s) 218
HpyAV CCTTC 1 cut(s) 34
HpyCH4III ACNGT 1 cut(s) 280
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 4 cut(s) 4, 148, 226, 247
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 1 cut(s) 360
HpySE526I ACGT 1 cut(s) 220
HspAI GCGC 1 cut(s) 352
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 4 cut(s) 58, 104, 150, 172
LpnPI CCDG 7 cut(s) 27, 75, 108, 180, 213, 312, 339
LweI GCATC 1 cut(s) 55
MaeI CTAG 2 cut(s) 102, 376
MaeII ACGT 1 cut(s) 220
MalI GATC 4 cut(s) 60, 106, 152, 174
MboI GATC 4 cut(s) 58, 104, 150, 172
MboII GAAGA 4 cut(s) 49, 62, 241, 357
MflI RGATCY 1 cut(s) 104
MluCI AATT 4 cut(s) 115, 180, 189, 332
MnlI CCTC 3 cut(s) 39, 79, 293
MseI TTAA 2 cut(s) 258, 297
MslI CAYNNNNRTG 2 cut(s) 239, 327
MspR9I CCNGG 1 cut(s) 327
MvaI CCWGG 1 cut(s) 327
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 4 cut(s) 58, 104, 150, 172
NsbI TGCGCA 1 cut(s) 353
OliI CACNNNNGTG 1 cut(s) 327
PflMI CCANNNNNTGG 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 325
PspGI CCWGG 1 cut(s) 325
PsuI RGATCY 1 cut(s) 104
RseI CAYNNNNRTG 2 cut(s) 239, 327
SaqAI TTAA 2 cut(s) 258, 297
Sau3AI GATC 4 cut(s) 58, 104, 150, 172
ScrFI CCNGG 1 cut(s) 327
SetI ASST 5 cut(s) 31, 223, 253, 274, 331
SfaNI GCATC 1 cut(s) 55
SmiMI CAYNNNNRTG 2 cut(s) 239, 327
Sse9I AATT 4 cut(s) 115, 180, 189, 332
SspMI CTAG 2 cut(s) 102, 376
StyD4I CCNGG 1 cut(s) 325
TaaI ACNGT 1 cut(s) 280
TaiI ACGT 1 cut(s) 223
TaqI TCGA 2 cut(s) 153, 285
TasI AATT 4 cut(s) 115, 180, 189, 332
Tru1I TTAA 2 cut(s) 258, 297
Tru9I TTAA 2 cut(s) 258, 297
TspDTI ATGAA 3 cut(s) 63, 147, 171
Van91I CCANNNNNTGG 1 cut(s) 17
XapI RAATTY 1 cut(s) 180
XbaI TCTAGA 1 cut(s) 101
XspI CTAG 2 cut(s) 102, 376
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.