Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005261.1

Orthogroup ID

OG0003921

Physical Location & Seq

Genomic Coordinates Forward (+)

20256 .. 21251

Gene Structure 996 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005261.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 537 bp

atgggttcaagtggtgctgttgctgacaccaattacagagaaaataaagcaacagaagcccatgatcaatacctgcagaaaggagtgagacacttgtgtgaaggagggctgactagagttccaaccaagtacatactgcccaaggaggaacgacccaattcagcaacaagagagactattctcaagttaccagttattgatttcgctcagttgcaaggctccagcagcagatcccaggcattgaactccctcgcaaaatcttgcgaagaatttggaatttttcagttgataaaccatggtatcacagatgaagttatatccagaatggctgatgtaagtaaaaggttttttgagcttcctttcgatgagagatcaaagtacatgtcaaaggatatggcttccccagttaggtatggaacaagctttaaccaaaacaatgatgaagtgttctgctggagagactttctcaagcttagttgccatcctttatcagacagtgttccttcttggccatcatctcctgtgaacctaaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

178

Amino Acids

20.11

Weight (kDa)

6.9

Isoelectric Point (pI)

60.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003921)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G36690 AT2G36690
fragaria_vesca	FvH4_6g17160 FvH4_7g06780 FvH4_7g06780
malus_domestica	MD07G1074700.v1.1 MD12G1103300.v1.1
prunus_persica	Prupe.2G095000_v2.0.a1 Prupe.7G123400_v2.0.a1 Prupe.7G123400_v2.0.a1
pyrus_communis	pycom07g05870 pycom12g10180
rosa_chinensis	RchiOBHm_Chr1g0336381 RchiOBHm_Chr3g0471251
rosa_laevigata	RLG00000024194 RLG00000029370
rosa_multiflora	Rmu_sc0000393.1_g000004 Rmu_sc0000393.1_g000005 Rmu_sc0004870.1_g000002 Rmu_sc0005261.1_g000001
rosa_roxburghii	Rroxscaffold_4G00315710 Rroxscaffold_6G00410170
rosa_rugosa	Rorug01G0125400 Rorug03G0116300
rosa_samantha	Rh1AG144600 Rh1BG114200 Rh1CG136100 Rh1DG151300 Rh3AG165700 Rh3BG191100 Rh3CG181400 Rh3DG184600
rosa_wichuraiana	Rw1G011860 Rw3G015600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	81
AclWI	GGATC	1 cut(s)	225
AcoI	YGGCCR	1 cut(s)	509
AcsI	RAATTY	2 cut(s)	269, 276
AfaI	GTAC	2 cut(s)	131, 380
AfiI	CCNNNNNNNGG	1 cut(s)	408
AflIII	ACRYGT	1 cut(s)	381
AgsI	TTSAA	2 cut(s)	9, 244
AjnI	CCWGG	1 cut(s)	234
AleI	CACNNNNGTG	1 cut(s)	96
AluBI	AGCT	3 cut(s)	355, 423, 472
AluI	AGCT	3 cut(s)	355, 423, 472
Alw26I	GTCTC	3 cut(s)	82, 167, 453
AlwI	GGATC	1 cut(s)	225
AoxI	GGCC	1 cut(s)	509
ApeKI	GCWGC	1 cut(s)	225
ApoI	RAATTY	2 cut(s)	269, 276
ArsI	GACNNNNNNTTYG	2 cut(s)	368, 400
AxyI	CCTNAGG	1 cut(s)	530
BaeI	ACNNNNGTAYC	2 cut(s)	283, 316
BalI	TGGCCA	1 cut(s)	511
BbvI	GCAGC	1 cut(s)	237
BccI	CCATC	2 cut(s)	489, 520
BciT130I	CCWGG	1 cut(s)	236
BclI	TGATCA	1 cut(s)	64
BcoDI	GTCTC	3 cut(s)	82, 167, 453
BfaI	CTAG	1 cut(s)	114
BfmI	CTRYAG	1 cut(s)	74
BfuAI	ACCTGC	1 cut(s)	81
BisI	GCNGC	1 cut(s)	226
BlsI	GCNGC	1 cut(s)	227
Bme1390I	CCNGG	1 cut(s)	236
BmiI	GGNNCC	1 cut(s)	220
BmrFI	CCNGG	1 cut(s)	236
BmrI	ACTGGG	1 cut(s)	398
BmuI	ACTGGG	1 cut(s)	398
BplI	GAGNNNNNCTC	2 cut(s)	450, 482
BpmI	CTGGAG	2 cut(s)	205, 475
BpuEI	CTTGAG	2 cut(s)	167, 452
BsaJI	CCNNGG	3 cut(s)	141, 234, 295
Bsc4I	CCNNNNNNNGG	1 cut(s)	408
Bse1I	ACTGG	2 cut(s)	191, 404
Bse21I	CCTNAGG	1 cut(s)	530
BseBI	CCWGG	1 cut(s)	236
BseDI	CCNNGG	3 cut(s)	141, 234, 295
BseGI	GGATG	1 cut(s)	481
BseLI	CCNNNNNNNGG	1 cut(s)	408
BseMII	CTCAG	1 cut(s)	221
BseNI	ACTGG	2 cut(s)	191, 404
BseXI	GCAGC	1 cut(s)	237
BshFI	GGCC	1 cut(s)	511
BslI	CCNNNNNNNGG	1 cut(s)	408
BsmAI	GTCTC	3 cut(s)	82, 167, 453
BsnI	GGCC	1 cut(s)	511
Bsp143I	GATC	3 cut(s)	64, 230, 371
Bsp19I	CCATGG	1 cut(s)	295
BspANI	GGCC	1 cut(s)	511
BspCNI	CTCAG	1 cut(s)	220
BspLI	GGNNCC	1 cut(s)	220
BspMAI	CTGCAG	1 cut(s)	78
BspMI	ACCTGC	1 cut(s)	81
BspPI	GGATC	1 cut(s)	225
BsrI	ACTGG	2 cut(s)	191, 404
BssECI	CCNNGG	3 cut(s)	141, 234, 295
BssMI	GATC	3 cut(s)	64, 230, 371
BssT1I	CCWWGG	2 cut(s)	141, 295
Bst2UI	CCWGG	1 cut(s)	236
Bst4CI	ACNGT	1 cut(s)	497
BstDEI	CTNAG	3 cut(s)	207, 473, 530
BstDSI	CCRYGG	1 cut(s)	295
BstF5I	GGATG	1 cut(s)	481
BstKTI	GATC	3 cut(s)	67, 233, 374
BstMAI	GTCTC	3 cut(s)	82, 167, 453
BstMBI	GATC	3 cut(s)	64, 230, 371
BstMWI	GCNNNNNNNGC	2 cut(s)	56, 225
BstNI	CCWGG	1 cut(s)	236
BstNSI	RCATGY	1 cut(s)	385
BstSCI	CCNGG	1 cut(s)	234
BstSFI	CTRYAG	1 cut(s)	74
BstV1I	GCAGC	1 cut(s)	237
BstX2I	RGATCY	1 cut(s)	230
BstYI	RGATCY	1 cut(s)	230
Bsu36I	CCTNAGG	1 cut(s)	530
BsuRI	GGCC	1 cut(s)	511
BtgI	CCRYGG	1 cut(s)	295
BtsCI	GGATG	1 cut(s)	481
BtsIMutI	CAGTG	1 cut(s)	502
BveI	ACCTGC	1 cut(s)	81
Csp6I	GTAC	2 cut(s)	130, 379
CviAII	CATG	3 cut(s)	62, 296, 382
CviJI	RGCY	9 cut(s)	59, 109, 219, 329, 355, 398, 423, 472, 511
CviKI_1	RGCY	9 cut(s)	59, 109, 219, 329, 355, 398, 423, 472, 511
CviQI	GTAC	2 cut(s)	130, 379
DdeI	CTNAG	3 cut(s)	207, 473, 530
DpnI	GATC	3 cut(s)	66, 232, 373
DpnII	GATC	3 cut(s)	64, 230, 371
EaeI	YGGCCR	1 cut(s)	509
Eco130I	CCWWGG	2 cut(s)	141, 295
Eco81I	CCTNAGG	1 cut(s)	530
EcoRII	CCWGG	1 cut(s)	234
EcoT14I	CCWWGG	2 cut(s)	141, 295
ErhI	CCWWGG	2 cut(s)	141, 295
FaeI	CATG	3 cut(s)	65, 299, 385
FaiI	YATR	7 cut(s)	63, 134, 297, 317, 383, 395, 414
FatI	CATG	3 cut(s)	61, 295, 381
FbaI	TGATCA	1 cut(s)	64
Fnu4HI	GCNGC	1 cut(s)	226
FokI	GGATG	1 cut(s)	468
Fsp4HI	GCNGC	1 cut(s)	226
FspBI	CTAG	1 cut(s)	114
GluI	GCNGC	1 cut(s)	226
GsuI	CTGGAG	2 cut(s)	205, 475
HaeIII	GGCC	1 cut(s)	511
Hin1II	CATG	3 cut(s)	65, 299, 385
HindIII	AAGCTT	2 cut(s)	421, 470
Hpy166II	GTNNAC	1 cut(s)	526
Hpy188I	TCNGA	1 cut(s)	493
Hpy188III	TCNNGA	1 cut(s)	321
Hpy8I	GTNNAC	1 cut(s)	526
HpyAV	CCTTC	2 cut(s)	95, 513
HpyCH4III	ACNGT	1 cut(s)	497
HpyCH4V	TGCA	2 cut(s)	76, 214
HpyF10VI	GCNNNNNNNGC	2 cut(s)	56, 225
HpyF3I	CTNAG	3 cut(s)	207, 473, 530
Hsp92II	CATG	3 cut(s)	65, 299, 385
Ksp22I	TGATCA	1 cut(s)	64
Kzo9I	GATC	3 cut(s)	64, 230, 371
LmnI	GCTCC	1 cut(s)	224
LpnPI	CCDG	8 cut(s)	86, 204, 221, 235, 248, 334, 417, 439
Lsp1109I	GCAGC	1 cut(s)	237
MaeI	CTAG	1 cut(s)	114
MaeIII	GTNAC	1 cut(s)	186
MalI	GATC	3 cut(s)	66, 232, 373
MboI	GATC	3 cut(s)	64, 230, 371
MboII	GAAGA	1 cut(s)	278
MflI	RGATCY	1 cut(s)	230
MlsI	TGGCCA	1 cut(s)	511
MluCI	AATT	4 cut(s)	31, 157, 269, 276
MluNI	TGGCCA	1 cut(s)	511
MmeI	TCCRAC	1 cut(s)	146
MnlI	CCTC	3 cut(s)	98, 139, 260
Mox20I	TGGCCA	1 cut(s)	511
MscI	TGGCCA	1 cut(s)	511
MseI	TTAA	1 cut(s)	426
MslI	CAYNNNNRTG	1 cut(s)	96
Msp20I	TGGCCA	1 cut(s)	511
MspR9I	CCNGG	1 cut(s)	236
MvaI	CCWGG	1 cut(s)	236
MwoI	GCNNNNNNNGC	2 cut(s)	56, 225
NcoI	CCATGG	1 cut(s)	295
NdeII	GATC	3 cut(s)	64, 230, 371
NlaIII	CATG	3 cut(s)	65, 299, 385
NlaIV	GGNNCC	1 cut(s)	220
NspI	RCATGY	1 cut(s)	385
OliI	CACNNNNGTG	1 cut(s)	96
PciI	ACATGT	1 cut(s)	381
PkrI	GCNGC	1 cut(s)	227
PscI	ACATGT	1 cut(s)	381
Psp6I	CCWGG	1 cut(s)	234
PspGI	CCWGG	1 cut(s)	234
PspN4I	GGNNCC	1 cut(s)	220
PstI	CTGCAG	1 cut(s)	78
PsuI	RGATCY	1 cut(s)	230
RsaI	GTAC	2 cut(s)	131, 380
RsaNI	GTAC	2 cut(s)	130, 379
RseI	CAYNNNNRTG	1 cut(s)	96
SaqAI	TTAA	1 cut(s)	426
SatI	GCNGC	1 cut(s)	226
Sau3AI	GATC	3 cut(s)	64, 230, 371
ScrFI	CCNGG	1 cut(s)	236
SetI	ASST	8 cut(s)	75, 347, 357, 413, 425, 474, 531, 536
SfcI	CTRYAG	1 cut(s)	74
SmiMI	CAYNNNNRTG	1 cut(s)	96
SmlI	CTYRAG	2 cut(s)	182, 467
SmoI	CTYRAG	2 cut(s)	182, 467
Sse9I	AATT	4 cut(s)	31, 157, 269, 276
SspMI	CTAG	1 cut(s)	114
StyD4I	CCNGG	1 cut(s)	234
StyI	CCWWGG	2 cut(s)	141, 295
TaaI	ACNGT	1 cut(s)	497
TaqI	TCGA	1 cut(s)	363
TasI	AATT	4 cut(s)	31, 157, 269, 276
TatI	WGTACW	2 cut(s)	129, 378
Tru1I	TTAA	1 cut(s)	426
Tru9I	TTAA	1 cut(s)	426
TscAI	CASTG	1 cut(s)	502
TseI	GCWGC	1 cut(s)	225
TspDTI	ATGAA	2 cut(s)	324, 456
TspRI	CASTG	1 cut(s)	502
XapI	RAATTY	2 cut(s)	269, 276
XceI	RCATGY	1 cut(s)	385
XspI	CTAG	1 cut(s)	114

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.