Rmu_sc0005426.1_g000013

QWRF motif-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005426.1
Physical Location & Seq
Reverse (-)
49728 .. 52091
2364 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005426.1_g000013.1.cds

Sequence Viewer

Length: 381 bp
attacttatttggaagaatgggctcttctggacagagatcactctagttctttgctaggagcgaatgaagctttgcaagccagtacccttcgtcttccagtcgttggaaaagcaatagttgactttcaaaagctgaaagattctgtgggctcagcagctgatgtgatgcaggcaatggcatcctcgatatgctcgctttcatcaaaggtggaagaaatgaattccttggtatctgaacttgtgaaggtgactacaacagaacgtcttgtgcttgaacaatgcaaagattttttgtcaacgttatcagccatgcaagtcaaggactgtagcttgagaacacatataatacaactaaaacgtctaccattacccgcagcctga

Protein Analysis

126

Amino Acids

13.75

Weight (kDa)

5.65

Isoelectric Point (pI)

31.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 104
AccI GTMKAC 1 cut(s) 361
AciI CCGC 1 cut(s) 372
AclI AACGTT 1 cut(s) 299
AcsI RAATTY 1 cut(s) 220
AfaI GTAC 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 104
AgsI TTSAA 2 cut(s) 128, 275
AluBI AGCT 4 cut(s) 71, 133, 158, 330
AluI AGCT 4 cut(s) 71, 133, 158, 330
AlwNI CAGNNNCTG 1 cut(s) 158
ApeKI GCWGC 2 cut(s) 155, 374
ApoI RAATTY 1 cut(s) 220
AsuHPI GGTGA 1 cut(s) 259
BanII GRGCYC 2 cut(s) 25, 152
BbsI GAAGAC 1 cut(s) 86
BbvI GCAGC 1 cut(s) 167
BfaI CTAG 2 cut(s) 45, 56
BfmI CTRYAG 1 cut(s) 325
BisI GCNGC 2 cut(s) 156, 375
BlpI GCTNAGC 1 cut(s) 151
BlsI GCNGC 2 cut(s) 157, 376
BmsI GCATC 2 cut(s) 156, 188
BpiI GAAGAC 1 cut(s) 86
Bpu1102I GCTNAGC 1 cut(s) 151
BpuEI CTTGAG 1 cut(s) 352
BsaJI CCNNGG 1 cut(s) 225
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse1I ACTGG 2 cut(s) 81, 98
Bse3DI GCAATG 1 cut(s) 180
BseDI CCNNGG 1 cut(s) 225
BseGI GGATG 1 cut(s) 179
BseLI CCNNNNNNNGG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 180
BseMII CTCAG 1 cut(s) 165
BseNI ACTGG 2 cut(s) 81, 98
BseXI GCAGC 1 cut(s) 167
BslI CCNNNNNNNGG 1 cut(s) 104
Bsp1286I GDGCHC 2 cut(s) 25, 152
Bsp143I GATC 1 cut(s) 37
Bsp1720I GCTNAGC 1 cut(s) 151
BspACI CCGC 1 cut(s) 372
BspCNI CTCAG 1 cut(s) 164
BspQI GCTCTTC 1 cut(s) 30
BsrDI GCAATG 1 cut(s) 180
BsrI ACTGG 2 cut(s) 81, 98
BssECI CCNNGG 1 cut(s) 225
BssMI GATC 1 cut(s) 37
BssT1I CCWWGG 1 cut(s) 225
Bst4CI ACNGT 1 cut(s) 326
Bst6I CTCTTC 1 cut(s) 30
BstC8I GCNNGC 3 cut(s) 78, 171, 194
BstDEI CTNAG 1 cut(s) 151
BstF5I GGATG 1 cut(s) 179
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstMWI GCNNNNNNNGC 2 cut(s) 68, 77
BstSFI CTRYAG 1 cut(s) 325
BstV1I GCAGC 1 cut(s) 167
BstV2I GAAGAC 1 cut(s) 86
BtsCI GGATG 1 cut(s) 179
Cac8I GCNNGC 3 cut(s) 78, 171, 194
CaiI CAGNNNCTG 1 cut(s) 158
Csp6I GTAC 1 cut(s) 84
CviAII CATG 1 cut(s) 310
CviJI RGCY 9 cut(s) 23, 71, 80, 133, 150, 158, 308, 330, 377
CviKI_1 RGCY 9 cut(s) 23, 71, 80, 133, 150, 158, 308, 330, 377
CviQI GTAC 1 cut(s) 84
DdeI CTNAG 1 cut(s) 151
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
Eam1104I CTCTTC 1 cut(s) 30
EarI CTCTTC 1 cut(s) 30
Eco130I CCWWGG 1 cut(s) 225
Eco24I GRGCYC 2 cut(s) 25, 152
EcoRI GAATTC 1 cut(s) 220
EcoT14I CCWWGG 1 cut(s) 225
EcoT38I GRGCYC 2 cut(s) 25, 152
ErhI CCWWGG 1 cut(s) 225
FaeI CATG 1 cut(s) 313
FaiI YATR 4 cut(s) 190, 311, 342, 344
FatI CATG 1 cut(s) 309
FauI CCCGC 1 cut(s) 379
FblI GTMKAC 1 cut(s) 361
Fnu4HI GCNGC 2 cut(s) 156, 375
FokI GGATG 1 cut(s) 166
FriOI GRGCYC 2 cut(s) 25, 152
Fsp4HI GCNGC 2 cut(s) 156, 375
FspBI CTAG 2 cut(s) 45, 56
GluI GCNGC 2 cut(s) 156, 375
Hin1II CATG 1 cut(s) 313
HincII GTYRAC 2 cut(s) 121, 297
HindII GTYRAC 2 cut(s) 121, 297
HindIII AAGCTT 1 cut(s) 69
HinfI GANTC 1 cut(s) 140
HphI GGTGA 1 cut(s) 259
Hpy166II GTNNAC 3 cut(s) 121, 297, 362
Hpy188I TCNGA 1 cut(s) 235
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 3 cut(s) 121, 297, 362
HpyAV CCTTC 2 cut(s) 98, 238
HpyCH4III ACNGT 1 cut(s) 326
HpyCH4IV ACGT 3 cut(s) 262, 299, 358
HpyCH4V TGCA 4 cut(s) 76, 169, 282, 313
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 77
HpyF3I CTNAG 1 cut(s) 151
HpySE526I ACGT 3 cut(s) 262, 299, 358
Hsp92II CATG 1 cut(s) 313
Kzo9I GATC 1 cut(s) 37
LguI GCTCTTC 1 cut(s) 30
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 4 cut(s) 14, 94, 111, 155
Lsp1109I GCAGC 1 cut(s) 167
LweI GCATC 2 cut(s) 156, 188
MaeI CTAG 2 cut(s) 45, 56
MaeII ACGT 3 cut(s) 262, 299, 358
MaeIII GTNAC 1 cut(s) 247
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 4 cut(s) 17, 26, 86, 224
MhlI GDGCHC 2 cut(s) 25, 152
MluCI AATT 1 cut(s) 220
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 1 cut(s) 193
MspA1I CMGCKG 1 cut(s) 158
MwoI GCNNNNNNNGC 2 cut(s) 68, 77
NdeII GATC 1 cut(s) 37
NlaIII CATG 1 cut(s) 313
NmuCI GTSAC 1 cut(s) 247
PciSI GCTCTTC 1 cut(s) 30
PfeI GAWTC 1 cut(s) 140
PflMI CCANNNNNTGG 1 cut(s) 104
PkrI GCNGC 2 cut(s) 157, 376
Psp1406I AACGTT 1 cut(s) 299
PstNI CAGNNNCTG 1 cut(s) 158
PvuII CAGCTG 1 cut(s) 158
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SapI GCTCTTC 1 cut(s) 30
SatI GCNGC 2 cut(s) 156, 375
Sau3AI GATC 1 cut(s) 37
SduI GDGCHC 2 cut(s) 25, 152
SetI ASST 9 cut(s) 73, 135, 160, 210, 249, 265, 302, 332, 361
SfaNI GCATC 2 cut(s) 156, 188
SfcI CTRYAG 1 cut(s) 325
SmlI CTYRAG 1 cut(s) 331
SmoI CTYRAG 1 cut(s) 331
Sse9I AATT 1 cut(s) 220
SsiI CCGC 1 cut(s) 372
SspMI CTAG 2 cut(s) 45, 56
StyI CCWWGG 1 cut(s) 225
TaaI ACNGT 1 cut(s) 326
TaiI ACGT 3 cut(s) 265, 302, 361
TaqI TCGA 1 cut(s) 185
TasI AATT 1 cut(s) 220
TfiI GAWTC 1 cut(s) 140
TseFI GTSAC 1 cut(s) 247
TseI GCWGC 2 cut(s) 155, 374
Tsp45I GTSAC 1 cut(s) 247
TspDTI ATGAA 3 cut(s) 81, 189, 233
Van91I CCANNNNNTGG 1 cut(s) 104
XapI RAATTY 1 cut(s) 220
XmiI GTMKAC 1 cut(s) 361
XspI CTAG 2 cut(s) 45, 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.