Rmu_sc0005901.1_g000002

DNA helicase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005901.1
Physical Location & Seq
Forward (+)
7851 .. 18606
10756 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005901.1_g000002.1.cds

Sequence Viewer

Length: 4521 bp
atggaccacaggcgccaatccaaggattctctctcctcctcctactccaacctcttcaatcttgagcctttgatgaactttcagcttccacagccagatgatgattttgattattacggcaatagcagtcaggatgagagcagaggtagccaaggtggagctgctggtaatgggattatgtccgaccgcgaactgaattcagtaaagaaaaggaggcggtctcaaaacagtgattacgaggaggatgacagttattacgggacgcacattacggaggacaagtatagatcaatgcttggagaacacattcagaagtacaaaaggaggttcaaggattccccgtcaagtcctgcaccaatccagatggggattccggtttcaaagggtaataagggttcgaaatcgaggaagctggcgaatgagaaccgaggagggttttatgaaatggaaaccacgtctgagtggctcaatgatactattcctcagaaaccagggaactaccatgatgctgattttgcgccacaaagtgccgctgatagagtaatatatgaacctccttatctggatattggtgatggtttcacatacaagattccaccaatttatgataaactggtgacatctttacacttgccgagcttttctgattttcgggtggaggaagtttacttaaaaggtacattggatttgggatccttagcagaaatgatgggtagcgataaaaggtttggtccaaaaaatcgggcaggaatgggggagccctatccccagtatgagtcccttcaggcaagattaaaggccttgtccacttctacctctgctcaaaagttcagcctcaaagtttctgatattgggttgaattcctccatcccagagggggcagctggaactataaagaggtctattttgtccgagggtggtgtcttgcaagtctactatgtgaaggttttggagaagggagacacatatgagataattgaacgaagcctacccaagaagcaaaaggtacagaaagatccttctcagattgagaaggaggaaatggaaaggatgggaagagtttgggtaaacattgtaagaagagacataccaaagcatcatagaatgtttactacttttcaccgcaagcaactaattgatgccaagagggtctcagagaactgtcaaagagaggtaaaaatgaaggtgagtagatcacttaaagtgatgaggggtgctgcaattcgcacaaggaaactagccagagacatgctactgctttggaagagaatagataaagagatggcagaagtgaggaagaaagaggaaaaagaagctattgaaatgcgcaagcgtctggaggaggaaagagaagcaaagagacaggagcaaagactcaattttctcataaaacaaaccgaactttacagtcacttcatgcagaacaagttgagttcacagccatctgaagacttgcctgtaggagatgaaaaccaagatgtatctccaagctcctcagatattgagaatgttgaagaagattctgaggaagctgaactgaagaaggaggcattaaaagctgctcaagatgcagtttcaaagcagaaaaagttaactagtgcatttgatgacgagtgtctgaggctgcgtgaagcctctgaacctgaggcaccacaggatgttgctggagctaataacattgatctgcataacccttccactatgcctgttacatcaaccgttcagacaccagagttgttcaaaggctcccttaaagaataccagctaaaaggcctccagtggctggttaattgttatgagcagggtttaaatggcatccttgctgatgagatgggcctgggtaagaccatccaggccatggcatttttggctcatttggctgaggagaaaaatatatgggggccttttctggttgttgctcctgcttccgtcttgaacaactgggctgatgaaattagtcgtttctgccccgacttaaaaactcttccgtattggggtggccttcaagagcgtatggtacttaggaagaagatcaacgctaagaaactttaccgtagggatgctgggtttcacattctcattaccagctaccagttgctagtgggtgatgagaagtgtttccggcgtgtgaaatggcaatatatggtattggatgaagcacaagctatcaaaagttctaacagtataagatggaagacactgctcagctttaattgtcgaaatcgtttgctgcttactggtacacctatccagaataatatggcagagttgtgggccctactacatttcattatgccaaccttatttgacagtcatgaacaattcaatgagtggttctctaaaggaattgaaaatcatgcggaacatgggggtactttgaacgagcaccagcttaacagattgcattcgatattgaagccattcatgctccgtcgagttaagacagatgtgatttctgagctgaccaggaaaactgaagttactgtgcactgcaagttgagttctcggcaacaagctttttatcaagctatcaaaaacaagatatctcttgctgagctgtttgacaacaatcgtgggcatcttaatgagaagaaaattttgaacttaatgaatattgtcattcagctaagaaaggtctgcaaccatcctgagttatttgagaggaatgaaggaagcacatatcttcactttggtgagatttcaaattctcttcttcctccaccatttggggagttggaggacgtacactactcgggaggtcaaaatcctataacatacgaggtccccaaacttttatatcaagaaatactccagaattctgaaacgttttgctctgcagttcggcatggtgtctacagtgaatcttttcagaaacattttaacatattttcaccgcaaaatgtgtatcgatcaatattcttgcaagagaatgactcagatgagttgtcggttggaagtggaacgtttggttttactcatctgatggatctgtcccctgcagaggttgcatttttaggaactggttcttttatggagcggctaatgttttccattatgagatgggaccggcagtttttggatggattgatagacacactaatggaaaccaaggatgatgatgattctgaatgcagcttccttgagagtggaaaagtgagagctgttacacgtatgttgctgatgccttcaagatctataactaccatctttcagaagaaattggccactggacctggtggtactccatttgagggtctagttgtctctcatcgggacaggcttctctctaatattaggcttctccgttcgacatacacattcatcccccgaactagagctcccccagttaatgtccattgctcagatcgaaacttcacttacaaaatgagtgaagaacaacagtacccctgggtgaagaggttgttttctggttttgcgcgaacatctgactacaatggacccagaaaacctgagactcctcatcatctaatacaagagattgattctgaactgcctgtttcacattcagctcttcagttgacatacagaatttttgggtcttgtcctccaatgcaaagcttcgacccgtcaaaaatgctcactgattcggggaaacttcagacacttgatatattgttgaaacgcttgagggcagaaaatcatcgtgttctcttgtttgcacagatgacaaagatgctgaatattcttgaggactacatgaactacaggaaatatagatacctcagactggatggatcttccaccattatggatcgtagagacatggtcagagacttccagcaacgaagtgatatttttgttttcttgctgagtacaagagctggtggactaggcattaacttgacagctgcagatactgtcatattttatgaaagtgattggaatccgaccctggatctacaggcaatggatagagctcatcggttgggccagactaaagatgttactgtctaccgcctaatttgtaaagaaacggttgaggagaagattctgcaaagagcaagtcagaaaaatactgtgcagcagcttgtaatgatgggtggtcatgttcaaggtgaccttttggctcccgaggatgttgtatctctacttctcgatgatgcccagttggagcagaaattaagagaagctccatcacaggatagacaaaagaagaaacagacaaagggtatacgggtagatgcagaaggtgatgcctctttggaagatttaacaaacactgctgcatcacaaggtactggaaatgaggaatctccagatgtcgaaagatcaaaatccaataataaaaagaggaaaacggtgcctgacaagcatactcctcgaccgaagaatcctcaaagtatggatgaaccagagggctatgaattggaggattccttacaaaatactgatccacaaggtacaagacccaagaggccaaagaggtcaaagaagagtgtaaatgaaactcttgaacctgcatttacagcggcatcccctgtggtcccgaggcagacctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1506

Amino Acids

172.32

Weight (kDa)

7.96

Isoelectric Point (pI)

53.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 1328
Acc36I ACCTGC 1 cut(s) 4486
AccB1I GGYRCC 3 cut(s) 12, 1648, 4321
AccB7I CCANNNNNTGG 3 cut(s) 1783, 1858, 2726
AccBSI CCGCTC 1 cut(s) 3037
AccI GTMKAC 4 cut(s) 933, 2853, 3972, 4192
AccII CGCG 2 cut(s) 189, 3439
AciI CCGC 9 cut(s) 187, 217, 531, 1123, 2360, 2894, 3037, 3976, 4490
AclI AACGTT 2 cut(s) 2825, 2963
AclWI GGATC 8 cut(s) 687, 700, 1010, 2994, 3763, 3780, 3924, 4406
AcoI YGGCCR 1 cut(s) 3222
AcsI RAATTY 6 cut(s) 196, 859, 2595, 2704, 2815, 3549
AcuI CTGAAG 6 cut(s) 767, 1467, 1559, 2496, 3518, 3602
AcyI GRCGYC 1 cut(s) 13
AdeI CACNNNGTG 1 cut(s) 527
AfiI CCNNNNNNNGG 9 cut(s) 22, 877, 1783, 1858, 1994, 2726, 3001, 3251, 3748
AflIII ACRYGT 1 cut(s) 3167
AhlI ACTAGT 1 cut(s) 1595
AjiI CACGTC 1 cut(s) 456
AjnI CCWGG 7 cut(s) 490, 1836, 1851, 2465, 3232, 3407, 3912
AleI CACNNNNGTG 1 cut(s) 2691
AloI GAACNNNNNNTCC 2 cut(s) 3322, 3354
Alw21I GWGCWC 4 cut(s) 2388, 2490, 3340, 3940
Alw44I GTGCAC 1 cut(s) 2486
AlwI GGATC 8 cut(s) 687, 700, 1010, 2994, 3763, 3780, 3924, 4406
AlwNI CAGNNNCTG 2 cut(s) 1783, 3878
Ama87I CYCGRG 3 cut(s) 2752, 4091, 4507
ApaI GGGCCC 1 cut(s) 2278
ApaLI GTGCAC 1 cut(s) 2486
ApoI RAATTY 6 cut(s) 196, 859, 2595, 2704, 2815, 3549
ArsI GACNNNNNNTTYG 2 cut(s) 4009, 4041
Asp700I GAANNNNTTC 5 cut(s) 306, 2117, 2420, 2865, 3022
AspLEI GCGC 4 cut(s) 15, 520, 1329, 3439
AsuII TTCGAA 1 cut(s) 398
AvaI CYCGRG 3 cut(s) 2752, 4091, 4507
AvaII GGWCC 7 cut(s) 4, 731, 2782, 3064, 3230, 3458, 4504
AxyI CCTNAGG 1 cut(s) 1644
BaeGI GKGCMC 2 cut(s) 2278, 2490
BaeI ACNNNNGTAYC 2 cut(s) 3386, 3419
BalI TGGCCA 1 cut(s) 3224
BamHI GGATCC 1 cut(s) 692
BanI GGYRCC 3 cut(s) 12, 1648, 4321
BanII GRGCYC 4 cut(s) 762, 2278, 3340, 3940
BarI GAAGNNNNNNTAC 2 cut(s) 4095, 4127
BbsI GAAGAC 2 cut(s) 1455, 2201
Bbv12I GWGCWC 4 cut(s) 2388, 2490, 3340, 3940
BbvCI CCTCAGC 1 cut(s) 1881
BceAI ACGGC 1 cut(s) 133
BcgI CGANNNNNNTGC 2 cut(s) 4322, 4356
BciT130I CCWGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
BcuI ACTAGT 1 cut(s) 1595
BfaI CTAG 6 cut(s) 1238, 1596, 2099, 3257, 3333, 3851
BfmI CTRYAG 7 cut(s) 1458, 2835, 2854, 2997, 3724, 3870, 3920
BfoI RGCGCY 1 cut(s) 16
BfuAI ACCTGC 1 cut(s) 4486
BglII AGATCT 1 cut(s) 3191
BlpI GCTNAGC 2 cut(s) 2204, 2553
Bme1390I CCNGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
Bme18I GGWCC 7 cut(s) 4, 731, 2782, 3064, 3230, 3458, 4504
BmeT110I CYCGRG 3 cut(s) 2752, 4091, 4507
BmgBI CACGTC 1 cut(s) 456
BmrFI CCNGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
BmrI ACTGGG 4 cut(s) 763, 1951, 3338, 4120
BmuI ACTGGG 4 cut(s) 763, 1951, 3338, 4120
BoxI GACNNNNGTC 1 cut(s) 1614
BpiI GAAGAC 2 cut(s) 1455, 2201
BplI GAGNNNNNCTC 6 cut(s) 205, 237, 2321, 2353, 2918, 2950
BpmI CTGGAG 5 cut(s) 1358, 1686, 1760, 2795, 4260
Bpu10I CCTNAGC 2 cut(s) 697, 1881
Bpu1102I GCTNAGC 2 cut(s) 2204, 2553
Bpu14I TTCGAA 1 cut(s) 398
BpuEI CTTGAG 5 cut(s) 83, 1548, 3161, 3667, 3728
Bsa29I ATCGAT 1 cut(s) 2908
BsaAI YACGTR 1 cut(s) 3170
BsaBI GATNNNNATC 2 cut(s) 3903, 4294
BsaHI GRCGYC 1 cut(s) 13
BsaI GGTCTC 2 cut(s) 225, 1156
BsaWI WCCGGW 1 cut(s) 373
BsaXI ACNNNNNCTCC 4 cut(s) 266, 296, 3322, 3352
Bsc4I CCNNNNNNNGG 9 cut(s) 22, 877, 1783, 1858, 1994, 2726, 3001, 3251, 3748
Bse118I RCCGGY 1 cut(s) 3066
Bse21I CCTNAGG 1 cut(s) 1644
Bse3DI GCAATG 2 cut(s) 3355, 3933
Bse8I GATNNNNATC 2 cut(s) 3903, 4294
BseBI CCWGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
BseCI ATCGAT 1 cut(s) 2908
BseJI GATNNNNATC 2 cut(s) 3903, 4294
BseLI CCNNNNNNNGG 9 cut(s) 22, 877, 1783, 1858, 1994, 2726, 3001, 3251, 3748
BseMI GCAATG 2 cut(s) 3355, 3933
BseSI GKGCMC 2 cut(s) 2278, 2490
BseYI CCCAGC 1 cut(s) 2063
BsgI GTGCAG 2 cut(s) 336, 4061
Bsh1236I CGCG 2 cut(s) 189, 3439
Bsh1285I CGRYCG 2 cut(s) 187, 4346
BshNI GGYRCC 3 cut(s) 12, 1648, 4321
BshVI ATCGAT 1 cut(s) 2908
BsiEI CGRYCG 2 cut(s) 187, 4346
BsiHKAI GWGCWC 4 cut(s) 2388, 2490, 3340, 3940
BsiHKCI CYCGRG 3 cut(s) 2752, 4091, 4507
BsiSI CCGG 3 cut(s) 374, 2122, 3067
BslFI GGGAC 7 cut(s) 274, 763, 2768, 2977, 3077, 3287, 4490
BslI CCNNNNNNNGG 9 cut(s) 22, 877, 1783, 1858, 1994, 2726, 3001, 3251, 3748
BsmFI GGGAC 7 cut(s) 274, 763, 2768, 2977, 3077, 3287, 4490
BsmI GAATGC 2 cut(s) 2404, 3134
Bso31I GGTCTC 2 cut(s) 225, 1156
BsoBI CYCGRG 3 cut(s) 2752, 4091, 4507
Bsp119I TTCGAA 1 cut(s) 398
Bsp120I GGGCCC 1 cut(s) 2274
Bsp1286I GDGCHC 6 cut(s) 762, 2278, 2388, 2490, 3340, 3940
Bsp1720I GCTNAGC 2 cut(s) 2204, 2553
Bsp19I CCATGG 1 cut(s) 1857
BspACI CCGC 9 cut(s) 187, 217, 531, 1123, 2360, 2894, 3037, 3976, 4490
BspDI ATCGAT 1 cut(s) 2908
BspFNI CGCG 2 cut(s) 189, 3439
BspHI TCATGA 1 cut(s) 2314
BspMAI CTGCAG 3 cut(s) 2839, 3001, 3874
BspMI ACCTGC 1 cut(s) 4486
BspPI GGATC 8 cut(s) 687, 700, 1010, 2994, 3763, 3780, 3924, 4406
BspQI GCTCTTC 1 cut(s) 3537
BspT104I TTCGAA 1 cut(s) 398
BspT107I GGYRCC 3 cut(s) 12, 1648, 4321
BspTNI GGTCTC 2 cut(s) 225, 1156
BsrBI CCGCTC 1 cut(s) 3037
BsrDI GCAATG 2 cut(s) 3355, 3933
BsrFI RCCGGY 1 cut(s) 3066
BssAI RCCGGY 1 cut(s) 3066
BssNAI GTATAC 1 cut(s) 4193
BssNI GRCGYC 1 cut(s) 13
BssT1I CCWWGG 4 cut(s) 21, 151, 1857, 3108
Bst1107I GTATAC 1 cut(s) 4193
Bst2UI CCWGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
Bst6I CTCTTC 9 cut(s) 59, 1051, 1075, 1259, 1989, 2715, 3410, 3537, 4448
BstACI GRCGYC 1 cut(s) 13
BstAPI GCANNNNNTGC 1 cut(s) 3005
BstBAI YACGTR 1 cut(s) 3170
BstBI TTCGAA 1 cut(s) 398
BstC8I GCNNGC 3 cut(s) 414, 1127, 1331
BstDSI CCRYGG 1 cut(s) 1857
BstEII GGTNACC 1 cut(s) 4076
BstFNI CGCG 2 cut(s) 189, 3439
BstH2I RGCGCY 1 cut(s) 16
BstHHI GCGC 4 cut(s) 15, 520, 1329, 3439
BstMCI CGRYCG 2 cut(s) 187, 4346
BstNI CCWGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
BstNSI RCATGY 1 cut(s) 1252
BstPAI GACNNNNGTC 1 cut(s) 1614
BstPI GGTNACC 1 cut(s) 4076
BstSCI CCNGG 7 cut(s) 490, 1836, 1851, 2465, 3232, 3407, 3912
BstSFI CTRYAG 7 cut(s) 1458, 2835, 2854, 2997, 3724, 3870, 3920
BstSLI GKGCMC 2 cut(s) 2278, 2490
BstUI CGCG 2 cut(s) 189, 3439
BstV2I GAAGAC 2 cut(s) 1455, 2201
BstX2I RGATCY 6 cut(s) 692, 1015, 2986, 3191, 3755, 3916
BstXI CCANNNNNNTGG 1 cut(s) 3769
BstYI RGATCY 6 cut(s) 692, 1015, 2986, 3191, 3755, 3916
BstZ17I GTATAC 1 cut(s) 4193
Bsu15I ATCGAT 1 cut(s) 2908
Bsu36I CCTNAGG 1 cut(s) 1644
BsuTUI ATCGAT 1 cut(s) 2908
BtgI CCRYGG 1 cut(s) 1857
BtrI CACGTC 1 cut(s) 456
BtsI GCAGTG 3 cut(s) 2198, 2488, 4239
BtsIMutI CAGTG 8 cut(s) 235, 1784, 2198, 2488, 2863, 3225, 3600, 4239
BveI ACCTGC 1 cut(s) 4486
Cac8I GCNNGC 3 cut(s) 414, 1127, 1331
CaiI CAGNNNCTG 2 cut(s) 1783, 3878
CciI TCATGA 1 cut(s) 2314
CfoI GCGC 4 cut(s) 15, 520, 1329, 3439
Cfr10I RCCGGY 1 cut(s) 3066
ClaI ATCGAT 1 cut(s) 2908
CseI GACGC 2 cut(s) 271, 1322
CsiI ACCWGGT 1 cut(s) 3232
CspCI CAANNNNNGTGG 2 cut(s) 2554, 2589
DinI GGCGCC 1 cut(s) 14
DraI TTTAAA 1 cut(s) 1809
DraIII CACNNNGTG 1 cut(s) 527
EaeI YGGCCR 1 cut(s) 3222
Eam1104I CTCTTC 9 cut(s) 59, 1051, 1075, 1259, 1989, 2715, 3410, 3537, 4448
EarI CTCTTC 9 cut(s) 59, 1051, 1075, 1259, 1989, 2715, 3410, 3537, 4448
Ecl136II GAGCTC 2 cut(s) 3338, 3938
Eco130I CCWWGG 4 cut(s) 21, 151, 1857, 3108
Eco147I AGGCCT 2 cut(s) 800, 1773
Eco24I GRGCYC 4 cut(s) 762, 2278, 3340, 3940
Eco31I GGTCTC 2 cut(s) 225, 1156
Eco32I GATATC 1 cut(s) 2544
Eco47I GGWCC 7 cut(s) 4, 731, 2782, 3064, 3230, 3458, 4504
Eco53kI GAGCTC 2 cut(s) 3338, 3938
Eco57I CTGAAG 6 cut(s) 767, 1467, 1559, 2496, 3518, 3602
Eco81I CCTNAGG 1 cut(s) 1644
Eco88I CYCGRG 3 cut(s) 2752, 4091, 4507
Eco91I GGTNACC 1 cut(s) 4076
EcoICRI GAGCTC 2 cut(s) 3338, 3938
EcoO109I RGGNCCY 3 cut(s) 1901, 2275, 2782
EcoO65I GGTNACC 1 cut(s) 4076
EcoRI GAATTC 3 cut(s) 196, 859, 2815
EcoRII CCWGG 7 cut(s) 490, 1836, 1851, 2465, 3232, 3407, 3912
EcoRV GATATC 1 cut(s) 2544
EcoT14I CCWWGG 4 cut(s) 21, 151, 1857, 3108
EcoT38I GRGCYC 4 cut(s) 762, 2278, 3340, 3940
EgeI GGCGCC 1 cut(s) 14
EheI GGCGCC 1 cut(s) 14
ErhI CCWWGG 4 cut(s) 21, 151, 1857, 3108
FalI AAGNNNNNCTT 4 cut(s) 1734, 1766, 4065, 4097
FaqI GGGAC 7 cut(s) 274, 763, 2768, 2977, 3077, 3287, 4490
FauNDI CATATG 1 cut(s) 967
FblI GTMKAC 4 cut(s) 933, 2853, 3972, 4192
FriOI GRGCYC 4 cut(s) 762, 2278, 3340, 3940
FspBI CTAG 6 cut(s) 1238, 1596, 2099, 3257, 3333, 3851
FspI TGCGCA 1 cut(s) 1328
GlaI GCGC 4 cut(s) 14, 519, 1328, 3438
GsaI CCCAGC 1 cut(s) 2067
GsuI CTGGAG 5 cut(s) 1358, 1686, 1760, 2795, 4260
HaeII RGCGCY 1 cut(s) 16
HapII CCGG 3 cut(s) 374, 2122, 3067
HgaI GACGC 2 cut(s) 271, 1322
HhaI GCGC 4 cut(s) 15, 520, 1329, 3439
Hin1I GRCGYC 1 cut(s) 13
Hin6I GCGC 4 cut(s) 13, 518, 1327, 3437
HinP1I GCGC 4 cut(s) 13, 518, 1327, 3437
HincII GTYRAC 2 cut(s) 1593, 3540
HindII GTYRAC 2 cut(s) 1593, 3540
HindIII AAGCTT 2 cut(s) 2514, 3577
HpaI GTTAAC 1 cut(s) 1593
HpaII CCGG 3 cut(s) 374, 2122, 3067
Hpy99I CGWCG 1 cut(s) 2436
HpyCH4IV ACGT 5 cut(s) 455, 2742, 2825, 2963, 3169
HpySE526I ACGT 5 cut(s) 455, 2742, 2825, 2963, 3169
Hsp92I GRCGYC 1 cut(s) 13
HspAI GCGC 4 cut(s) 13, 518, 1327, 3437
KasI GGCGCC 1 cut(s) 12
KspAI GTTAAC 1 cut(s) 1593
LguI GCTCTTC 1 cut(s) 3537
MabI ACCWGGT 1 cut(s) 3232
MaeI CTAG 6 cut(s) 1238, 1596, 2099, 3257, 3333, 3851
MaeII ACGT 5 cut(s) 455, 2742, 2825, 2963, 3169
MaeIII GTNAC 7 cut(s) 616, 1409, 1708, 2479, 3163, 3964, 4076
MbiI CCGCTC 1 cut(s) 3037
MflI RGATCY 6 cut(s) 692, 1015, 2986, 3191, 3755, 3916
MhlI GDGCHC 6 cut(s) 762, 2278, 2388, 2490, 3340, 3940
MlsI TGGCCA 1 cut(s) 3224
MluNI TGGCCA 1 cut(s) 3224
Mly113I GGCGCC 1 cut(s) 13
MlyI GAGTC 4 cut(s) 785, 1368, 2927, 3469
MmeI TCCRAC 6 cut(s) 72, 207, 2715, 2932, 3932, 4110
Mox20I TGGCCA 1 cut(s) 3224
MroXI GAANNNNTTC 5 cut(s) 306, 2117, 2420, 2865, 3022
MscI TGGCCA 1 cut(s) 3224
MslI CAYNNNNRTG 4 cut(s) 2583, 2691, 3098, 3767
Msp20I TGGCCA 1 cut(s) 3224
MspA1I CMGCKG 4 cut(s) 533, 884, 3869, 4490
MspI CCGG 3 cut(s) 374, 2122, 3067
MspR9I CCNGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
Mva1269I GAATGC 2 cut(s) 2404, 3134
MvaI CCWGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
MvnI CGCG 2 cut(s) 189, 3439
NarI GGCGCC 1 cut(s) 13
NcoI CCATGG 1 cut(s) 1857
NdeI CATATG 1 cut(s) 967
NmeAIII GCCGAG 2 cut(s) 660, 2485
NmuCI GTSAC 3 cut(s) 616, 1409, 4076
NsbI TGCGCA 1 cut(s) 1328
NspI RCATGY 1 cut(s) 1252
NspV TTCGAA 1 cut(s) 398
OliI CACNNNNGTG 1 cut(s) 2691
PagI TCATGA 1 cut(s) 2314
PasI CCCWGGG 1 cut(s) 3408
PceI AGGCCT 2 cut(s) 800, 1773
PciSI GCTCTTC 1 cut(s) 3537
PctI GAATGC 2 cut(s) 2404, 3134
PdmI GAANNNNTTC 5 cut(s) 306, 2117, 2420, 2865, 3022
PflFI GACNNNGTC 1 cut(s) 3785
PflMI CCANNNNNTGG 3 cut(s) 1783, 1858, 2726
PleI GAGTC 4 cut(s) 784, 1368, 2927, 3469
PluTI GGCGCC 1 cut(s) 16
PpsI GAGTC 4 cut(s) 784, 1368, 2927, 3469
Ppu21I YACGTR 1 cut(s) 3170
PpuMI RGGWCCY 1 cut(s) 2782
PshAI GACNNNNGTC 1 cut(s) 1614
Psp124BI GAGCTC 2 cut(s) 3340, 3940
Psp1406I AACGTT 2 cut(s) 2825, 2963
Psp5II RGGWCCY 1 cut(s) 2782
Psp6I CCWGG 7 cut(s) 490, 1836, 1851, 2465, 3232, 3407, 3912
PspEI GGTNACC 1 cut(s) 4076
PspFI CCCAGC 1 cut(s) 2063
PspGI CCWGG 7 cut(s) 490, 1836, 1851, 2465, 3232, 3407, 3912
PspOMI GGGCCC 1 cut(s) 2274
PspPPI RGGWCCY 1 cut(s) 2782
PsrI GAACNNNNNNTAC 4 cut(s) 379, 411, 972, 1004
PstI CTGCAG 3 cut(s) 2839, 3001, 3874
PstNI CAGNNNCTG 2 cut(s) 1783, 3878
PsuI RGATCY 6 cut(s) 692, 1015, 2986, 3191, 3755, 3916
PsyI GACNNNGTC 1 cut(s) 3785
PvuII CAGCTG 2 cut(s) 884, 3869
RseI CAYNNNNRTG 4 cut(s) 2583, 2691, 3098, 3767
SacI GAGCTC 2 cut(s) 3340, 3940
SapI GCTCTTC 1 cut(s) 3537
SchI GAGTC 4 cut(s) 785, 1368, 2927, 3469
ScrFI CCNGG 7 cut(s) 492, 1838, 1853, 2467, 3234, 3409, 3914
SduI GDGCHC 6 cut(s) 762, 2278, 2388, 2490, 3340, 3940
SexAI ACCWGGT 1 cut(s) 3232
SfcI CTRYAG 7 cut(s) 1458, 2835, 2854, 2997, 3724, 3870, 3920
SfoI GGCGCC 1 cut(s) 14
SfuI TTCGAA 1 cut(s) 398
SinI GGWCC 7 cut(s) 4, 731, 2782, 3064, 3230, 3458, 4504
SmiMI CAYNNNNRTG 4 cut(s) 2583, 2691, 3098, 3767
SmlI CTYRAG 5 cut(s) 62, 1563, 3140, 3646, 3707
SmoI CTYRAG 5 cut(s) 62, 1563, 3140, 3646, 3707
SpeI ACTAGT 1 cut(s) 1595
SseBI AGGCCT 2 cut(s) 800, 1773
SsiI CCGC 9 cut(s) 187, 217, 531, 1123, 2360, 2894, 3037, 3976, 4490
SspDI GGCGCC 1 cut(s) 12
SspI AATATT 4 cut(s) 2614, 2916, 3292, 3703
SspMI CTAG 6 cut(s) 1238, 1596, 2099, 3257, 3333, 3851
SstI GAGCTC 2 cut(s) 3340, 3940
StuI AGGCCT 2 cut(s) 800, 1773
StyD4I CCNGG 7 cut(s) 490, 1836, 1851, 2465, 3232, 3407, 3912
StyI CCWWGG 4 cut(s) 21, 151, 1857, 3108
TaiI ACGT 5 cut(s) 458, 2745, 2828, 2966, 3172
TaqII GACCGA 1 cut(s) 4360
TatI WGTACW 2 cut(s) 315, 3833
TauI GCSGC 3 cut(s) 533, 3040, 4493
TscAI CASTG 8 cut(s) 235, 1784, 2205, 2495, 2863, 3232, 3607, 4246
TseFI GTSAC 3 cut(s) 616, 1409, 4076
Tsp45I GTSAC 3 cut(s) 616, 1409, 4076
TspGWI ACGGA 5 cut(s) 287, 1918, 1977, 2420, 3293
TspRI CASTG 8 cut(s) 235, 1784, 2205, 2495, 2863, 3232, 3607, 4246
Tth111I GACNNNGTC 1 cut(s) 3785
Van91I CCANNNNNTGG 3 cut(s) 1783, 1858, 2726
VneI GTGCAC 1 cut(s) 2486
VpaK11BI GGWCC 7 cut(s) 4, 731, 2782, 3064, 3230, 3458, 4504
XapI RAATTY 6 cut(s) 196, 859, 2595, 2704, 2815, 3549
XceI RCATGY 1 cut(s) 1252
XcmI CCANNNNNNNNNTGG 2 cut(s) 1855, 1864
XmiI GTMKAC 4 cut(s) 933, 2853, 3972, 4192
XmnI GAANNNNTTC 5 cut(s) 306, 2117, 2420, 2865, 3022
XspI CTAG 6 cut(s) 1238, 1596, 2099, 3257, 3333, 3851
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.