Rmu_sc0005996.1_g000006
TCP Family

1-phosphatidylinositol-3-phosphate 5-kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005996.1
Physical Location & Seq
Forward (+)
33839 .. 42109
8271 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005996.1_g000006.1.cds

Sequence Viewer

Length: 5454 bp
atgggcacccctgacaacaaattgtcagagatagttgacattttcaagtcttggatgcccaggagaaccgagccaaccaatgtgtccagggacttttggatgcccgatcacagctgtagggtatgctacgactgtgattcccagttcacagtatttaatcgaaggcatcattgccgcctttgtggccgagttttctgcgctaggtgtactgcaaacactattcctgccccatctgatgagccaagaattggtagggaagacggggagaggattagggtctgtaatttttgcttcaagcaatgggagcaagggatagcagcagttgataatgggccccctgaacctagccctggcctcagtccatcaccatctacaacaagcttggtcagtaccaacacaagctgcacctaccacagtagcagcagcactgttggttctaccccttattcgactggaccttaccagcacgtgccctatagttctggtcttagccccagacaatcttgccaagatgattcagttactggcctgcaagacaatgtaacatctcagaggagcattagttctgacgctgccatggcagagtcgtctcccaaccagtttggcttttgcatggacaggagtgatgatgaggatgatgactatggttatcattcagattcagaatcaagacatttcacccatgccaatgactattatggtgcaatcaataacgaggagtttgatagtgtgtatgaaccacagaaggtgcattctgatggagaaaccacagatgcaaaatgtttgagctccttttcacctgagaagtttgatacacagagtgtagtgggaacgaaacttggggaagaatcagattatcatattaattgtgatgaatgtgaaacttctccatatgagatggagactacaaatgcagaaccggtggattttgagaataatgggctactttggctcccaccagaacctgaggatgaagaagatgacagagaagctgccttatttgaggatgatgatgatgatgagggtggtgatggtggtggtggtggtggtggtggtgctacaggggagtggggatatcttcattcttcaaacagttttggtggtggggagtgtcgtactagggagaagtcaattgaggagcacaggaaggccatgaagaatgtggtggaaggtcattttagagctctggtatctcagctcttgcaggttgaaaacctgccttcgattgatgaaaattacaaagagacttggttggacataattacgtctttgtcatgggaagctgccacacttcttaagccagatacgagcaaagggggaggaatggatcctgggggatatgtgaaggttaaatgcatagcttgtgggagtcggagcgagagcatggtggttaaaggagttgtttgcaagaaaaacgtggctcatcggcgaatgacttcaaagatagaaaaaccacgtttcttgatccttggaggagctttggaatatcagcgtgtatcaaaccacttgtccagtttcgatactttgttgcagcaggagatggaccatctgaagatggcagttgctaagatcgatgcacatcaccctaatgttttattggtggagaagtctgtatctcggtatgctcaagattaccttcttgcgaaagacatatcactcgttctgaatattaagaggccacttttggagcgaatatctcgctgcactggggcacaaattgtcccttcgatagatcatcttacatcaccaaaactagggtattgcgacatgttccatgtggagaaattttttgaagtgcatggcagtgctggacaaggtgggaagaaattaacaaagactctgatgttctttgaaggttgtccaaagccattgggtgttactatattgctgaagggtgccaatggggatgagttaaaaaaggtgaaacatgttgtgcagtatggagtttttgcagcttatcacttggctttggagacctcatttttagctgatgaaggagcttcccttccagaacttcctctgaagtctgtggtaactgtattgcctgataaaccgtcgagtattgacaggtccatttccaccatacctggttttagtgtaccagcagctggcaagcctcagagttccaatgctagcagtgaactgcagaactcaaataaaggcctcatttcagatagtggctcatttgcccaagttgcctccattttaaagaacgaaggcaccaatttggtctgcttacctaaagctccgtgttctcaaccttcccccataaaacataccccgagtcctatagaatatacatcttctttcacttccttgtctccccgaggacaggatacgacagactcctgccataaagagctttcttcaatttgtggctctgaggacaacaaggatgtaagttctaaagaatcttgtccagccaaaacagccaaggcaggcgaagctttagttcacgatagtttgatctctaattcttttagcacctcagaggcatttggacatggtggtggaattggcaatgctgatggcgttgctttagctgcaaatctcagagagactccagagcttccatccataaaatatcatactgataatcagaatgaggaggtgggatcttcaaaagaagagtttcccccctcaccttcagaccaccagagcattttggtttccctatcaacacgttgtgtgtggaaaggaactgtatgtgaacgagcccatctttttcgaatcaaatactatggaagctttgataagcctctggggaggtttttacgagaccatctttttgatcagggttacctctgtcgttcatgtgggatgccctcagaagcgcatattcattgttatactcatagacaaggaagccttacaatatctgttaagaaactcccagagattttcctgccaggggaaaaggaaggaaaaatatggatgtggcataggtgcttgagatgtcctcggaccagtggcttccctccagccactcgtagagttgtaatgtcagatgctgcttggggtttatcttttgggaaatttctggaattaagcttttcaaatcatgcagctgcaaacagagttgcaagctgtggtcattccctgcacagagattgtcttcggttttatgggtttgggagaatggttgcttgcttccgctatgcctcaattcatattcactctgtttgtctgcccccaccaaaacttgaattttactatgataatcaggaatggatacaaaaagaagcatacgaggtgggcaaccgggcggagcttctatttactgaattacatagtgctcttcatcagattttacagaagataaaagttgtggagacacaggatggtggtaagaaagcacctgaatcgactcatcaaattgtagaacttgaagggatgcttcaaaaggaaagggaagactctgagaaatcattacaaaaagtgataaagggggaggtgaaatctggccagcctgcaattgatattcttgagatcaataaattgcggaggcagttactcttccattcttatgtttgggaccagcgcctgattcgtgcagcgagtctaagcaataataaatttcaggaaggtttaaccagttccgttaccaaactcaaggagaaacctattggcatggagaaggttgtcaaaacaccaggaagaaatttcagtagttgtacagctcttcccgaaatcaagcctggtataaatcttaatcaaggaggagatgctggctactttagccagatgggaggggttcagaacagaactgaaatgggtctggacacagatcatgggaatgagacctctgcaaatgtccttgataaatctgatcctttggagtctgaaaaaattgtacaaatgggtctctcggaagagaatgaatgttcggctgtggaaagtttatctgatacccttgatgcggcttggactggtacaacccacccaactagtacaacatctagagagaatggctattcacttcctcatccaaccttggtaaaatcatcaactgtggtaaaaaatgttgcatccgctgtggaaaatggtactgttgaccaaggtggggtgcaggcaactcgttctcttatttctacatttcctgctgtcactagttcattcagtaaaagtgcttcctttaacactcaaaagctatgtattggtggtgagcacagtcctgtctatgttgcacggttccgggaactggaacggcatactggtgcgaggttgctactgccaattggtgttaatgatacagttatccctgtttttgatgatgagcccactagtgttattgcatataccctcgtctctcctaattatcatttgcagatttctgagcctgatagaccaattgattctgcagtctcattaccgctttttgattcagcgaatcttctctcactgaatgcttttgatgagtcagtttctgagacctacagaggtcttagttcttctgatgagagcatcttatccatgtcacattcgcggagctctgaatctcttgtgtcaaaggatatacatgctagagtatcctttacagatgaggggcccctcggtaaggtgaagtatacagtgacttgttactacgcatcgcagtttgaggcattaaggaaggcatgttgcccttccgaattagattttgtgcggtctcttagccgctgtaagaagtggggtgcccagggtggaaagagcaacgttttctttgctaagaccttggatgatcggtttatcatcaaacaagtcacaaagaccgagctggagtcatttatcaagtttgcaccagcttatttcaaatatttgtctcattcaatcagtactagaagcccaacttgcctagcaaagatcctgggtatctatcaggtttcatcaaaacatggtaaagcagggaaagagacaaagatggatgtcttagtaatggagaatctattatttagacggaatgtctcacggctttatgacctgaaaggatcttctcgatcacgttataatccagacacaagtggaagcaataaagtgctactggaccagaatctgattgaagcaatgcctacttctccaatttttttggggaacagggcaaagcggctattggagagagctgtctggaatgatactgcattccttgcttcaatcgatgtgatggactactcgttactggttggagtggatgaggaaaagcacgagctagttttggggatcattgatttcatgaggcaatatacatgggacaagcaccttgaaacttgggtgaaggcctcaggcatcctcggaggaccgaagaatacatctccaaccgtgatttcaccccagcagtataagaaacgtttcaggaaagctatggccacttactttctgatgcttcccgatcagtggtcgcctgaggcgattgtcccaagtgggtcgcaatctgaccattttgaagaaacttcccaagctcaatctgaagccttgtaa

Protein Analysis

1817

Amino Acids

200.54

Weight (kDa)

5.87

Isoelectric Point (pI)

48.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 4986
Acc36I ACCTGC 2 cut(s) 1195, 1224
AccB1I GGYRCC 4 cut(s) 5, 1895, 2219, 4673
AccB7I CCANNNNNTGG 2 cut(s) 248, 2108
AccI GTMKAC 1 cut(s) 4568
AccII CGCG 1 cut(s) 4486
AclI AACGTT 2 cut(s) 4695, 5323
AclWI GGATC 8 cut(s) 1322, 1335, 1459, 2623, 3824, 4837, 4975, 5204
AcoI YGGCCR 3 cut(s) 184, 3463, 5340
AcsI RAATTY 5 cut(s) 1784, 3035, 3206, 3575, 3661
AcuI CTGAAG 4 cut(s) 1571, 1910, 2042, 2631
AcvI CACGTG 1 cut(s) 469
AdeI CACNNNGTG 2 cut(s) 821, 2687
AflII CTTAAG 1 cut(s) 1295
AflIII ACRYGT 3 cut(s) 1767, 1927, 2681
AgeI ACCGGT 1 cut(s) 919
AhdI GACNNNNNGTC 1 cut(s) 4940
AhlI ACTAGT 3 cut(s) 3947, 4109, 4283
AjuI GAANNNNNNNTTGG 2 cut(s) 5284, 5316
AloI GAACNNNNNNTCC 2 cut(s) 547, 579
Alw21I GWGCWC 6 cut(s) 791, 1143, 1186, 3298, 4170, 4493
AlwI GGATC 8 cut(s) 1322, 1335, 1459, 2623, 3824, 4837, 4975, 5204
AlwNI CAGNNNCTG 7 cut(s) 524, 965, 2108, 3011, 3544, 4427, 5032
Ama87I CYCGRG 2 cut(s) 2281, 2325
ApaI GGGCCC 2 cut(s) 336, 4551
ApoI RAATTY 5 cut(s) 1784, 3035, 3206, 3575, 3661
ArsI GACNNNNNNTTYG 4 cut(s) 1493, 1525, 2771, 2803
AseI ATTAAT 1 cut(s) 864
AsiGI ACCGGT 1 cut(s) 919
Asp700I GAANNNNTTC 3 cut(s) 1435, 2631, 5324
AspLEI GCGC 3 cut(s) 200, 2836, 3543
AsuC2I CCSGG 2 cut(s) 3263, 4196
AsuII TTCGAA 1 cut(s) 2728
AsuNHI GCTAGC 1 cut(s) 2132
AvaI CYCGRG 2 cut(s) 2281, 2325
AvaII GGWCC 7 cut(s) 455, 1543, 2070, 2964, 3535, 5023, 5273
AxyI CCTNAGG 3 cut(s) 966, 5257, 5379
BaeGI GKGCMC 6 cut(s) 8, 336, 474, 1714, 4551, 4678
BalI TGGCCA 2 cut(s) 3465, 5342
BamHI GGATCC 1 cut(s) 1327
BanI GGYRCC 4 cut(s) 5, 1895, 2219, 4673
BanII GRGCYC 7 cut(s) 336, 791, 1186, 2719, 4281, 4493, 4551
BarI GAAGNNNNNNTAC 2 cut(s) 4114, 4146
BauI CACGAG 1 cut(s) 5180
BbrPI CACGTG 1 cut(s) 469
BbsI GAAGAC 3 cut(s) 264, 3107, 3420
Bbv12I GWGCWC 6 cut(s) 791, 1143, 1186, 3298, 4170, 4493
BceAI ACGGC 2 cut(s) 4223, 4964
BcgI CGANNNNNNTGC 6 cut(s) 177, 211, 3345, 3379, 4058, 4092
BciVI GTATCC 3 cut(s) 2329, 3225, 4540
BclI TGATCA 1 cut(s) 2791
BcnI CCSGG 2 cut(s) 3263, 4196
BcuI ACTAGT 3 cut(s) 3947, 4109, 4283
BfmI CTRYAG 7 cut(s) 115, 475, 1059, 2144, 2289, 4359, 4435
BfoI RGCGCY 1 cut(s) 3544
BfrI CTTAAG 1 cut(s) 1295
BfuAI ACCTGC 2 cut(s) 1195, 1224
BfuI GTATCC 3 cut(s) 2329, 3225, 4540
BglI GCCNNNNNGGC 1 cut(s) 183
BmcAI AGTACT 1 cut(s) 4816
Bme18I GGWCC 7 cut(s) 455, 1543, 2070, 2964, 3535, 5023, 5273
BmeRI GACNNNNNGTC 1 cut(s) 4940
BmeT110I CYCGRG 2 cut(s) 2281, 2325
BmrI ACTGGG 2 cut(s) 136, 1716
BmtI GCTAGC 1 cut(s) 2136
BmuI ACTGGG 2 cut(s) 136, 1716
BpiI GAAGAC 3 cut(s) 264, 3107, 3420
BplI GAGNNNNNCTC 2 cut(s) 2944, 2976
BpmI CTGGAG 3 cut(s) 2547, 2964, 4778
Bpu14I TTCGAA 1 cut(s) 2728
BpuEI CTTGAG 4 cut(s) 1611, 2971, 3506, 3596
BpuMI CCSGG 2 cut(s) 3263, 4196
Bsa29I ATCGAT 2 cut(s) 1572, 5133
BsaAI YACGTR 1 cut(s) 469
BsaBI GATNNNNATC 1 cut(s) 1578
BsaI GGTCTC 6 cut(s) 1967, 2772, 3794, 3869, 4424, 4653
BsaWI WCCGGW 1 cut(s) 919
BsaXI ACNNNNNCTCC 4 cut(s) 547, 577, 936, 966
Bse118I RCCGGY 1 cut(s) 919
Bse21I CCTNAGG 3 cut(s) 966, 5257, 5379
Bse3DI GCAATG 4 cut(s) 169, 305, 2527, 5049
Bse8I GATNNNNATC 1 cut(s) 1578
BseCI ATCGAT 2 cut(s) 1572, 5133
BseJI GATNNNNATC 1 cut(s) 1578
BseMI GCAATG 4 cut(s) 169, 305, 2527, 5049
BseRI GAGGAG 6 cut(s) 568, 731, 1151, 1488, 2621, 3735
BseSI GKGCMC 6 cut(s) 8, 336, 474, 1714, 4551, 4678
BseYI CCCAGC 1 cut(s) 5307
BsgI GTGCAG 6 cut(s) 388, 1687, 1955, 3086, 3573, 4088
Bsh1236I CGCG 1 cut(s) 4486
BshNI GGYRCC 4 cut(s) 5, 1895, 2219, 4673
BshTI ACCGGT 1 cut(s) 919
BshVI ATCGAT 2 cut(s) 1572, 5133
BsiHKAI GWGCWC 6 cut(s) 791, 1143, 1186, 3298, 4170, 4493
BsiHKCI CYCGRG 2 cut(s) 2281, 2325
BsiSI CCGG 3 cut(s) 920, 3262, 4195
BslFI GGGAC 5 cut(s) 104, 1706, 3548, 5240, 5375
BsmBI CGTCTC 2 cut(s) 594, 4312
BsmFI GGGAC 5 cut(s) 104, 1706, 3548, 5240, 5375
BsmI GAATGC 3 cut(s) 751, 4411, 5117
Bso31I GGTCTC 6 cut(s) 1967, 2772, 3794, 3869, 4424, 4653
BsoBI CYCGRG 2 cut(s) 2281, 2325
Bsp119I TTCGAA 1 cut(s) 2728
Bsp120I GGGCCC 2 cut(s) 332, 4547
Bsp1407I TGTACA 2 cut(s) 3674, 3853
Bsp19I CCATGG 1 cut(s) 576
BspDI ATCGAT 2 cut(s) 1572, 5133
BspFNI CGCG 1 cut(s) 4486
BspHI TCATGA 1 cut(s) 5208
BspMAI CTGCAG 2 cut(s) 2148, 4363
BspMI ACCTGC 2 cut(s) 1195, 1224
BspOI GCTAGC 1 cut(s) 2136
BspPI GGATC 8 cut(s) 1322, 1335, 1459, 2623, 3824, 4837, 4975, 5204
BspQI GCTCTTC 2 cut(s) 3303, 3687
BspT104I TTCGAA 1 cut(s) 2728
BspT107I GGYRCC 4 cut(s) 5, 1895, 2219, 4673
BspTI CTTAAG 1 cut(s) 1295
BspTNI GGTCTC 6 cut(s) 1967, 2772, 3794, 3869, 4424, 4653
BsrDI GCAATG 4 cut(s) 169, 305, 2527, 5049
BsrFI RCCGGY 1 cut(s) 919
BsrGI TGTACA 2 cut(s) 3674, 3853
BssAI RCCGGY 1 cut(s) 919
BssNAI GTATAC 1 cut(s) 4569
BssSI CACGAG 1 cut(s) 5180
BssT1I CCWWGG 6 cut(s) 576, 1468, 2433, 3993, 4057, 4713
Bst1107I GTATAC 1 cut(s) 4569
Bst2BI CACGAG 1 cut(s) 5180
Bst6I CTCTTC 5 cut(s) 2622, 3303, 3521, 3687, 3867
BstAFI CTTAAG 1 cut(s) 1295
BstAPI GCANNNNNTGC 1 cut(s) 5123
BstAUI TGTACA 2 cut(s) 3674, 3853
BstBAI YACGTR 1 cut(s) 469
BstBI TTCGAA 1 cut(s) 2728
BstDSI CCRYGG 1 cut(s) 576
BstEII GGTNACC 1 cut(s) 2798
BstENI CCTNNNNNAGG 1 cut(s) 4556
BstFNI CGCG 1 cut(s) 4486
BstH2I RGCGCY 1 cut(s) 3544
BstHHI GCGC 3 cut(s) 200, 2836, 3543
BstNSI RCATGY 4 cut(s) 1771, 1931, 4523, 4620
BstPI GGTNACC 1 cut(s) 2798
BstSFI CTRYAG 7 cut(s) 115, 475, 1059, 2144, 2289, 4359, 4435
BstSLI GKGCMC 6 cut(s) 8, 336, 474, 1714, 4551, 4678
BstUI CGCG 1 cut(s) 4486
BstV2I GAAGAC 3 cut(s) 264, 3107, 3420
BstX2I RGATCY 4 cut(s) 1327, 2615, 4842, 4967
BstYI RGATCY 4 cut(s) 1327, 2615, 4842, 4967
BstZ17I GTATAC 1 cut(s) 4569
Bsu15I ATCGAT 2 cut(s) 1572, 5133
Bsu36I CCTNAGG 3 cut(s) 966, 5257, 5379
BsuI GTATCC 3 cut(s) 2329, 3225, 4540
BsuTUI ATCGAT 2 cut(s) 1572, 5133
BtgI CCRYGG 1 cut(s) 576
BtgZI GCGATG 1 cut(s) 4575
BtsI GCAGTG 2 cut(s) 1810, 2143
BtsIMutI CAGTG 8 cut(s) 426, 1704, 1810, 2143, 2974, 4400, 4578, 5375
BveI ACCTGC 2 cut(s) 1195, 1224
CaiI CAGNNNCTG 7 cut(s) 524, 965, 2108, 3011, 3544, 4427, 5032
CciI TCATGA 1 cut(s) 5208
CfoI GCGC 3 cut(s) 200, 2836, 3543
Cfr10I RCCGGY 1 cut(s) 919
ClaI ATCGAT 2 cut(s) 1572, 5133
CseI GACGC 1 cut(s) 578
CsiI ACCWGGT 1 cut(s) 2086
CspAI ACCGGT 1 cut(s) 919
CspCI CAANNNNNGTGG 2 cut(s) 1443, 1478
DraI TTTAAA 1 cut(s) 2208
DraIII CACNNNGTG 2 cut(s) 821, 2687
DriI GACNNNNNGTC 1 cut(s) 4940
EaeI YGGCCR 3 cut(s) 184, 3463, 5340
Eam1104I CTCTTC 5 cut(s) 2622, 3303, 3521, 3687, 3867
Eam1105I GACNNNNNGTC 1 cut(s) 4940
EarI CTCTTC 5 cut(s) 2622, 3303, 3521, 3687, 3867
EciI GGCGGA 1 cut(s) 3281
Ecl136II GAGCTC 3 cut(s) 789, 1184, 4491
Eco130I CCWWGG 6 cut(s) 576, 1468, 2433, 3993, 4057, 4713
Eco147I AGGCCT 2 cut(s) 2163, 5255
Eco24I GRGCYC 7 cut(s) 336, 791, 1186, 2719, 4281, 4493, 4551
Eco31I GGTCTC 6 cut(s) 1967, 2772, 3794, 3869, 4424, 4653
Eco32I GATATC 1 cut(s) 1076
Eco47I GGWCC 7 cut(s) 455, 1543, 2070, 2964, 3535, 5023, 5273
Eco53kI GAGCTC 3 cut(s) 789, 1184, 4491
Eco57I CTGAAG 4 cut(s) 1571, 1910, 2042, 2631
Eco72I CACGTG 1 cut(s) 469
Eco81I CCTNAGG 3 cut(s) 966, 5257, 5379
Eco88I CYCGRG 2 cut(s) 2281, 2325
Eco91I GGTNACC 1 cut(s) 2798
EcoICRI GAGCTC 3 cut(s) 789, 1184, 4491
EcoNI CCTNNNNNAGG 1 cut(s) 4556
EcoO109I RGGNCCY 3 cut(s) 333, 4547, 4548
EcoO65I GGTNACC 1 cut(s) 2798
EcoRV GATATC 1 cut(s) 1076
EcoT14I CCWWGG 6 cut(s) 576, 1468, 2433, 3993, 4057, 4713
EcoT22I ATGCAT 1 cut(s) 1358
EcoT38I GRGCYC 7 cut(s) 336, 791, 1186, 2719, 4281, 4493, 4551
ErhI CCWWGG 6 cut(s) 576, 1468, 2433, 3993, 4057, 4713
Esp3I CGTCTC 2 cut(s) 594, 4312
FalI AAGNNNNNCTT 8 cut(s) 1620, 1652, 2853, 2885, 3381, 3413, 4813, 4845
FaqI GGGAC 5 cut(s) 104, 1706, 3548, 5240, 5375
FauNDI CATATG 1 cut(s) 892
FbaI TGATCA 1 cut(s) 2791
FblI GTMKAC 1 cut(s) 4568
FriOI GRGCYC 7 cut(s) 336, 791, 1186, 2719, 4281, 4493, 4551
GlaI GCGC 3 cut(s) 199, 2835, 3542
GsaI CCCAGC 1 cut(s) 5311
GsuI CTGGAG 3 cut(s) 2547, 2964, 4778
HaeII RGCGCY 1 cut(s) 3544
HapII CCGG 3 cut(s) 920, 3262, 4195
HgaI GACGC 1 cut(s) 578
HhaI GCGC 3 cut(s) 200, 2836, 3543
Hin6I GCGC 3 cut(s) 198, 2834, 3541
HinP1I GCGC 3 cut(s) 198, 2834, 3541
HincII GTYRAC 2 cut(s) 37, 4054
HindII GTYRAC 2 cut(s) 37, 4054
HindIII AAGCTT 4 cut(s) 379, 2445, 2746, 3049
HpaII CCGG 3 cut(s) 920, 3262, 4195
Hpy166II GTNNAC 9 cut(s) 37, 147, 207, 2099, 2141, 2455, 2711, 4054, 4569
Hpy8I GTNNAC 9 cut(s) 37, 147, 207, 2099, 2141, 2455, 2711, 4054, 4569
Hpy99I CGWCG 1 cut(s) 2059
HpyCH4IV ACGT 8 cut(s) 468, 1265, 1416, 1456, 2683, 4695, 4981, 5323
HpySE526I ACGT 8 cut(s) 468, 1265, 1416, 1456, 2683, 4695, 4981, 5323
HspAI GCGC 3 cut(s) 198, 2834, 3541
Ksp22I TGATCA 1 cut(s) 2791
LguI GCTCTTC 2 cut(s) 3303, 3687
MabI ACCWGGT 1 cut(s) 2086
MaeII ACGT 8 cut(s) 468, 1265, 1416, 1456, 2683, 4695, 4981, 5323
MfeI CAATTG 4 cut(s) 1131, 3474, 4236, 4350
MflI RGATCY 4 cut(s) 1327, 2615, 4842, 4967
MlsI TGGCCA 2 cut(s) 3465, 5342
MluNI TGGCCA 2 cut(s) 3465, 5342
MmeI TCCRAC 5 cut(s) 1233, 1352, 4013, 5140, 5315
Mox20I TGGCCA 2 cut(s) 3465, 5342
Mph1103I ATGCAT 1 cut(s) 1358
MroXI GAANNNNTTC 3 cut(s) 1435, 2631, 5324
MscI TGGCCA 2 cut(s) 3465, 5342
MslI CAYNNNNRTG 8 cut(s) 687, 756, 1587, 1803, 2508, 3525, 3795, 4215
Msp20I TGGCCA 2 cut(s) 3465, 5342
MspA1I CMGCKG 5 cut(s) 114, 2108, 3068, 4034, 4659
MspCI CTTAAG 1 cut(s) 1295
MspI CCGG 3 cut(s) 920, 3262, 4195
MunI CAATTG 4 cut(s) 1131, 3474, 4236, 4350
Mva1269I GAATGC 3 cut(s) 751, 4411, 5117
MvnI CGCG 1 cut(s) 4486
NciI CCSGG 2 cut(s) 3263, 4196
NcoI CCATGG 1 cut(s) 576
NdeI CATATG 1 cut(s) 892
NheI GCTAGC 1 cut(s) 2132
NmeAIII GCCGAG 1 cut(s) 212
NmuCI GTSAC 4 cut(s) 4105, 4476, 4573, 4741
NsiI ATGCAT 1 cut(s) 1358
NspI RCATGY 4 cut(s) 1771, 1931, 4523, 4620
NspV TTCGAA 1 cut(s) 2728
PagI TCATGA 1 cut(s) 5208
PasI CCCWGGG 1 cut(s) 4678
PceI AGGCCT 2 cut(s) 2163, 5255
PciI ACATGT 2 cut(s) 1767, 1927
PciSI GCTCTTC 2 cut(s) 3303, 3687
PcsI WCGNNNNNNNCGW 1 cut(s) 5381
PctI GAATGC 3 cut(s) 751, 4411, 5117
PdmI GAANNNNTTC 3 cut(s) 1435, 2631, 5324
PflMI CCANNNNNTGG 2 cut(s) 248, 2108
PfoI TCCNGGA 1 cut(s) 4194
PinAI ACCGGT 1 cut(s) 919
PmaCI CACGTG 1 cut(s) 469
PmlI CACGTG 1 cut(s) 469
Ppu21I YACGTR 1 cut(s) 469
PscI ACATGT 2 cut(s) 1767, 1927
PshBI ATTAAT 1 cut(s) 864
PsiI TTATAA 1 cut(s) 4986
Psp124BI GAGCTC 3 cut(s) 791, 1186, 4493
Psp1406I AACGTT 2 cut(s) 4695, 5323
PspCI CACGTG 1 cut(s) 469
PspEI GGTNACC 1 cut(s) 2798
PspFI CCCAGC 1 cut(s) 5307
PspOMI GGGCCC 2 cut(s) 332, 4547
PstI CTGCAG 2 cut(s) 2148, 4363
PstNI CAGNNNCTG 7 cut(s) 524, 965, 2108, 3011, 3544, 4427, 5032
PsuI RGATCY 4 cut(s) 1327, 2615, 4842, 4967
PvuII CAGCTG 3 cut(s) 114, 2108, 3068
RseI CAYNNNNRTG 8 cut(s) 687, 756, 1587, 1803, 2508, 3525, 3795, 4215
SacI GAGCTC 3 cut(s) 791, 1186, 4493
SapI GCTCTTC 2 cut(s) 3303, 3687
ScaI AGTACT 1 cut(s) 4816
SexAI ACCWGGT 1 cut(s) 2086
SfcI CTRYAG 7 cut(s) 115, 475, 1059, 2144, 2289, 4359, 4435
SfuI TTCGAA 1 cut(s) 2728
SinI GGWCC 7 cut(s) 455, 1543, 2070, 2964, 3535, 5023, 5273
SmiMI CAYNNNNRTG 8 cut(s) 687, 756, 1587, 1803, 2508, 3525, 3795, 4215
SmlI CTYRAG 5 cut(s) 1295, 1626, 2950, 3485, 3611
SmoI CTYRAG 5 cut(s) 1295, 1626, 2950, 3485, 3611
SpeI ACTAGT 3 cut(s) 3947, 4109, 4283
SseBI AGGCCT 2 cut(s) 2163, 5255
SspI AATATT 2 cut(s) 1669, 4796
SstI GAGCTC 3 cut(s) 791, 1186, 4493
StuI AGGCCT 2 cut(s) 2163, 5255
StyI CCWWGG 6 cut(s) 576, 1468, 2433, 3993, 4057, 4713
TaiI ACGT 8 cut(s) 471, 1268, 1419, 1459, 2686, 4698, 4984, 5326
TaqII GACCGA 2 cut(s) 4766, 5290
TatI WGTACW 5 cut(s) 206, 3674, 3853, 3950, 4814
TauI GCSGC 4 cut(s) 177, 3923, 4659, 5086
TscAI CASTG 8 cut(s) 433, 1711, 1810, 2143, 2974, 4407, 4578, 5375
TseFI GTSAC 4 cut(s) 4105, 4476, 4573, 4741
Tsp45I GTSAC 4 cut(s) 4105, 4476, 4573, 4741
TspGWI ACGGA 3 cut(s) 2238, 3589, 4951
TspRI CASTG 8 cut(s) 433, 1711, 1810, 2143, 2974, 4407, 4578, 5375
Van91I CCANNNNNTGG 2 cut(s) 248, 2108
Vha464I CTTAAG 1 cut(s) 1295
VpaK11BI GGWCC 7 cut(s) 455, 1543, 2070, 2964, 3535, 5023, 5273
VspI ATTAAT 1 cut(s) 864
XagI CCTNNNNNAGG 1 cut(s) 4556
XapI RAATTY 5 cut(s) 1784, 3035, 3206, 3575, 3661
XbaI TCTAGA 1 cut(s) 3959
XceI RCATGY 4 cut(s) 1771, 1931, 4523, 4620
XcmI CCANNNNNNNNNTGG 1 cut(s) 1159
XmiI GTMKAC 1 cut(s) 4568
XmnI GAANNNNTTC 3 cut(s) 1435, 2631, 5324
ZrmI AGTACT 1 cut(s) 4816
Zsp2I ATGCAT 1 cut(s) 1358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.