Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006004.1

Orthogroup ID

OG0006396

Physical Location & Seq

Genomic Coordinates Forward (+)

28188 .. 29150

Gene Structure 963 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006004.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 873 bp

atggatcagcgaaaatgggatcagttggactatggttgtttggtgaatatctttggaaaagttggaagaggtggtatggagtcattgctcatggatgttccttttgtctgcaagtcatggcatacagcaagccttgatcctaaatgttgggaaagtctcatttttcccatcattttcactagtctttataattctgatgttgaaactgaagactggacttttgatccctttttaaaaagatttgtttttgaataccgaatcaacaagagcttctccatcactgcattcataaagtttatggtcagtcgtagcaaaggatgtgctactgaaatcaggctacctgtgtgcgcttcagaagaagcactgaaacatgttgcagcttcgtgtcctcgcctaaagaatttgactttgcccactgatgtagtctactataaatcaagaatgatccctgatatgattggcaagtggaaagatttggagtatttgctaatgggaagctgctaccatgacatggagaaaatcatttcccaaataggccttcactgcaagaatttctattatttagatattcctgactgtctggttcgcaaagatgctgcattggcaattgcaaagttgcctaatcttaagcacataattatgatgaacgcaaatattgaacgggttaattttgttagattactgaagggctgccaaaaacttgtgtcattggatgccagaaattgtcttggtttcaatgcaggtgataaggaaatatcaaaacttgcttctcatatcagtgatttcaaatgccaaggttctagattttttgattgccattccaaggagggaaaatatgtttggtttcatgattctgtctatgatggacgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like

Protein Analysis

290

Amino Acids

33.45

Weight (kDa)

8.48

Isoelectric Point (pI)

37.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006396)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g33270
prunus_persica	Prupe.1G157900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0265521 RchiOBHm_Chr6g0265531
rosa_laevigata	RLG00000014182
rosa_multiflora	Rmu_co8123530.1_g000001 Rmu_co8387705.1_g000001 Rmu_sc0000217.1_g000007 Rmu_sc0000217.1_g000009 Rmu_sc0006004.1_g000006
rosa_roxburghii	Rroxscaffold_175G00432420 Rroxscaffold_175G00432440 Rroxscaffold_7G00202620 Rroxscaffold_7G00202640
rosa_rugosa	Rorug06G0017300
rosa_samantha	Rh6AG139500 Rh6AG139700 Rh6BG139100 Rh6BG139200 Rh6BG139600 Rh6CG136500 Rh6CG136600 Rh6CG136700 Rh6DG122700 Rh6DG123000
rosa_wichuraiana	Rw6G012010 Rw6G012020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	189
AarI	CACCTGC	1 cut(s)	731
Acc36I	ACCTGC	1 cut(s)	731
AccB7I	CCANNNNNTGG	1 cut(s)	511
AccI	GTMKAC	1 cut(s)	426
AclWI	GGATC	5 cut(s)	12, 27, 131, 218, 439
AcsI	RAATTY	2 cut(s)	400, 550
AcuI	CTGAAG	3 cut(s)	228, 336, 704
AfiI	CCNNNNNNNGG	2 cut(s)	511, 823
AflII	CTTAAG	1 cut(s)	626
AflIII	ACRYGT	1 cut(s)	370
AgsI	TTSAA	5 cut(s)	203, 251, 659, 736, 787
AhlI	ACTAGT	1 cut(s)	179
AjuI	GAANNNNNNNTTGG	4 cut(s)	522, 554, 823, 855
AluBI	AGCT	3 cut(s)	270, 380, 498
AluI	AGCT	3 cut(s)	270, 380, 498
Alw26I	GTCTC	1 cut(s)	161
AlwI	GGATC	5 cut(s)	12, 27, 131, 218, 439
AoxI	GGCC	1 cut(s)	535
ApeKI	GCWGC	4 cut(s)	377, 498, 596, 690
ApoI	RAATTY	2 cut(s)	400, 550
ArsI	GACNNNNNNTTYG	2 cut(s)	203, 235
AspLEI	GCGC	1 cut(s)	350
AsuHPI	GGTGA	2 cut(s)	55, 755
BbsI	GAAGAC	1 cut(s)	216
BbvI	GCAGC	4 cut(s)	389, 485, 583, 677
BccI	CCATC	3 cut(s)	176, 284, 857
BcoDI	GTCTC	1 cut(s)	161
BcuI	ACTAGT	1 cut(s)	179
BfaI	CTAG	2 cut(s)	180, 801
BfrI	CTTAAG	1 cut(s)	626
BfuAI	ACCTGC	1 cut(s)	731
BisI	GCNGC	4 cut(s)	378, 499, 597, 691
BlsI	GCNGC	4 cut(s)	379, 500, 598, 692
BmsI	GCATC	2 cut(s)	583, 703
BpiI	GAAGAC	1 cut(s)	216
BsaJI	CCNNGG	2 cut(s)	793, 822
Bsc4I	CCNNNNNNNGG	2 cut(s)	511, 823
Bse1I	ACTGG	1 cut(s)	218
Bse3DI	GCAATG	1 cut(s)	83
BseDI	CCNNGG	2 cut(s)	793, 822
BseGI	GGATG	3 cut(s)	100, 323, 718
BseLI	CCNNNNNNNGG	2 cut(s)	511, 823
BseMI	GCAATG	1 cut(s)	83
BseNI	ACTGG	1 cut(s)	218
BseXI	GCAGC	4 cut(s)	389, 485, 583, 677
BshFI	GGCC	1 cut(s)	537
BslI	CCNNNNNNNGG	2 cut(s)	511, 823
BsmAI	GTCTC	1 cut(s)	161
BsmI	GAATGC	1 cut(s)	284
BsnI	GGCC	1 cut(s)	537
Bsp143I	GATC	5 cut(s)	4, 19, 136, 223, 444
BspANI	GGCC	1 cut(s)	537
BspHI	TCATGA	1 cut(s)	847
BspMI	ACCTGC	1 cut(s)	731
BspPI	GGATC	5 cut(s)	12, 27, 131, 218, 439
BspTI	CTTAAG	1 cut(s)	626
BsrDI	GCAATG	1 cut(s)	83
BsrI	ACTGG	1 cut(s)	218
BssECI	CCNNGG	2 cut(s)	793, 822
BssMI	GATC	5 cut(s)	4, 19, 136, 223, 444
BssT1I	CCWWGG	2 cut(s)	793, 822
Bst4CI	ACNGT	1 cut(s)	578
Bst6I	CTCTTC	1 cut(s)	61
BstAFI	CTTAAG	1 cut(s)	626
BstC8I	GCNNGC	1 cut(s)	130
BstF5I	GGATG	3 cut(s)	100, 323, 718
BstHHI	GCGC	1 cut(s)	350
BstKTI	GATC	5 cut(s)	7, 22, 139, 226, 447
BstMAI	GTCTC	1 cut(s)	161
BstMBI	GATC	5 cut(s)	4, 19, 136, 223, 444
BstMWI	GCNNNNNNNGC	2 cut(s)	543, 602
BstNSI	RCATGY	1 cut(s)	374
BstV1I	GCAGC	4 cut(s)	389, 485, 583, 677
BstV2I	GAAGAC	1 cut(s)	216
BsuRI	GGCC	1 cut(s)	537
BtsCI	GGATG	3 cut(s)	100, 323, 718
BtsI	GCAGTG	2 cut(s)	279, 541
BtsIMutI	CAGTG	5 cut(s)	279, 362, 414, 541, 784
BveI	ACCTGC	1 cut(s)	731
Cac8I	GCNNGC	1 cut(s)	130
CciI	TCATGA	1 cut(s)	847
CfoI	GCGC	1 cut(s)	350
CviAII	CATG	6 cut(s)	91, 117, 371, 506, 511, 848
CviJI	RGCY	7 cut(s)	132, 270, 337, 380, 498, 537, 690
CviKI_1	RGCY	7 cut(s)	132, 270, 337, 380, 498, 537, 690
DpnI	GATC	5 cut(s)	6, 21, 138, 225, 446
DpnII	GATC	5 cut(s)	4, 19, 136, 223, 444
DraI	TTTAAA	1 cut(s)	234
Eam1104I	CTCTTC	1 cut(s)	61
EarI	CTCTTC	1 cut(s)	61
Eco130I	CCWWGG	2 cut(s)	793, 822
Eco147I	AGGCCT	1 cut(s)	537
Eco57I	CTGAAG	3 cut(s)	228, 336, 704
EcoT14I	CCWWGG	2 cut(s)	793, 822
ErhI	CCWWGG	2 cut(s)	793, 822
FaeI	CATG	6 cut(s)	94, 120, 374, 509, 514, 851
FatI	CATG	6 cut(s)	90, 116, 370, 505, 510, 847
FblI	GTMKAC	1 cut(s)	426
Fnu4HI	GCNGC	4 cut(s)	378, 499, 597, 691
FokI	GGATG	3 cut(s)	107, 330, 725
Fsp4HI	GCNGC	4 cut(s)	378, 499, 597, 691
FspBI	CTAG	2 cut(s)	180, 801
GlaI	GCGC	1 cut(s)	349
GluI	GCNGC	4 cut(s)	378, 499, 597, 691
HaeIII	GGCC	1 cut(s)	537
HhaI	GCGC	1 cut(s)	350
Hin1II	CATG	6 cut(s)	94, 120, 374, 509, 514, 851
Hin6I	GCGC	1 cut(s)	348
HinP1I	GCGC	1 cut(s)	348
HinfI	GANTC	3 cut(s)	80, 258, 851
HphI	GGTGA	2 cut(s)	55, 755
Hpy166II	GTNNAC	1 cut(s)	427
Hpy188I	TCNGA	2 cut(s)	196, 355
Hpy188III	TCNNGA	4 cut(s)	438, 572, 801, 848
Hpy8I	GTNNAC	1 cut(s)	427
HpyAV	CCTTC	2 cut(s)	548, 679
HpyCH4III	ACNGT	1 cut(s)	578
HpyCH4V	TGCA	7 cut(s)	111, 284, 377, 546, 599, 611, 740
HpyF10VI	GCNNNNNNNGC	2 cut(s)	543, 602
Hsp92II	CATG	6 cut(s)	94, 120, 374, 509, 514, 851
HspAI	GCGC	1 cut(s)	348
Kzo9I	GATC	5 cut(s)	4, 19, 136, 223, 444
LpnPI	CCDG	8 cut(s)	199, 319, 354, 462, 566, 585, 726, 730
Lsp1109I	GCAGC	4 cut(s)	389, 485, 583, 677
LweI	GCATC	2 cut(s)	583, 703
MaeI	CTAG	2 cut(s)	180, 801
MalI	GATC	5 cut(s)	6, 21, 138, 225, 446
MboI	GATC	5 cut(s)	4, 19, 136, 223, 444
MboII	GAAGA	3 cut(s)	78, 221, 368
MfeI	CAATTG	1 cut(s)	606
MluCI	AATT	7 cut(s)	190, 400, 550, 606, 636, 667, 721
MlyI	GAGTC	1 cut(s)	89
MmeI	TCCRAC	2 cut(s)	6, 43
MnlI	CCTC	3 cut(s)	62, 399, 820
MseI	TTAA	3 cut(s)	233, 627, 666
MslI	CAYNNNNRTG	2 cut(s)	638, 777
MspCI	CTTAAG	1 cut(s)	626
MunI	CAATTG	1 cut(s)	606
Mva1269I	GAATGC	1 cut(s)	284
MwoI	GCNNNNNNNGC	2 cut(s)	543, 602
NdeII	GATC	5 cut(s)	4, 19, 136, 223, 444
NlaIII	CATG	6 cut(s)	94, 120, 374, 509, 514, 851
NspI	RCATGY	1 cut(s)	374
PagI	TCATGA	1 cut(s)	847
PaqCI	CACCTGC	1 cut(s)	731
PceI	AGGCCT	1 cut(s)	537
PciI	ACATGT	1 cut(s)	370
PctI	GAATGC	1 cut(s)	284
PfeI	GAWTC	2 cut(s)	258, 851
PflMI	CCANNNNNTGG	1 cut(s)	511
PkrI	GCNGC	4 cut(s)	379, 500, 598, 692
PleI	GAGTC	1 cut(s)	88
PpsI	GAGTC	1 cut(s)	88
PscI	ACATGT	1 cut(s)	370
PsiI	TTATAA	1 cut(s)	189
RseI	CAYNNNNRTG	2 cut(s)	638, 777
SaqAI	TTAA	3 cut(s)	233, 627, 666
SatI	GCNGC	4 cut(s)	378, 499, 597, 691
Sau3AI	GATC	5 cut(s)	4, 19, 136, 223, 444
SchI	GAGTC	1 cut(s)	89
SetI	ASST	7 cut(s)	73, 272, 343, 382, 500, 745, 799
SfaNI	GCATC	2 cut(s)	583, 703
SmiMI	CAYNNNNRTG	2 cut(s)	638, 777
SmlI	CTYRAG	1 cut(s)	626
SmoI	CTYRAG	1 cut(s)	626
SpeI	ACTAGT	1 cut(s)	179
Sse9I	AATT	7 cut(s)	190, 400, 550, 606, 636, 667, 721
SseBI	AGGCCT	1 cut(s)	537
SspI	AATATT	1 cut(s)	655
SspMI	CTAG	2 cut(s)	180, 801
StuI	AGGCCT	1 cut(s)	537
StyI	CCWWGG	2 cut(s)	793, 822
TaaI	ACNGT	1 cut(s)	578
TasI	AATT	7 cut(s)	190, 400, 550, 606, 636, 667, 721
TfiI	GAWTC	2 cut(s)	258, 851
Tru1I	TTAA	3 cut(s)	233, 627, 666
Tru9I	TTAA	3 cut(s)	233, 627, 666
TscAI	CASTG	5 cut(s)	286, 369, 421, 548, 784
TseI	GCWGC	4 cut(s)	377, 498, 596, 690
TspDTI	ATGAA	3 cut(s)	277, 659, 836
TspRI	CASTG	5 cut(s)	286, 369, 421, 548, 784
Van91I	CCANNNNNTGG	1 cut(s)	511
Vha464I	CTTAAG	1 cut(s)	626
XapI	RAATTY	2 cut(s)	400, 550
XbaI	TCTAGA	1 cut(s)	800
XceI	RCATGY	1 cut(s)	374
XmiI	GTMKAC	1 cut(s)	426
XspI	CTAG	2 cut(s)	180, 801

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.