Rmu_sc0006005.1_g000016
ERF Family

RING FYVE PHD zinc finger superfamily protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006005.1
Physical Location & Seq
Reverse (-)
55397 .. 61149
5753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006005.1_g000016.1.cds

Sequence Viewer

Length: 4176 bp
atggggtcaaaggctgttgaggtttctgatgaaacctgtcatgttagcggggcgaatcagtgttctgtcaatgtgagtgataatttgtcttctttcaagagcaaggcatgtgacagtttacagcataccaccagtgagacaagtaacctacttagtgtcaattcgagttatgattctttgtctgaaaatgctgaaagcagagcacccctaaggttttctaatacttctgatgatttagaaggtgttgagaaacttccaaatacatacattgattctaaacttgttcaagttcatgaggataacatatcatgtgtaagtaaagcgaatgatacaaatacagcattcagtaatcataacaggaatgtagagaggaagaaccttgcttgtagtttagcttcagtcggtagtgtaggccctgaagaatttggaaagccacccaattcagtcttcttggagattcctcatttgaaaaatccaagttctggcagtggcagatcgaaggagagagtgccagaattctctggacttatggactcatcattaacaaaagaagcaattactagccagaaatttgcttcttataaaggtttggaggcctctacaaaaatttgtccaaagtttgaagcagagaccagtgatgatggccaagactcaaaacaggaagctttgaaattttcagatcatggtgaacaggatattaagtctagtcaggtggttggcgcagctgctatgcagcctttgcaatccgtcaatggtgatgacagtgatgaatctgatattgtggagcatgatgtaaaggtatgtgatatttgtggggacgcaggtcgtgaagaatcgcttgccacttgtagtagatgcagcgacggtgcagaacacatctattgcatgcgaaaaatgcttcggagagttcctaaaggtgactggttgtgtgaggaatgcaagttcactgagcaaactgaaaaccagaagcaagatttagatggaaacagaatgaagaaagccatcttgagtacccagctctctaataagagacgtgcagacaatacagaagcggctcctccttctaaaaggcagactcttgagactcgggtgggatcaccaaagccgcccagccctaagagaacagttgcattatcacgtgagtcttcattcaagagtatggataaggataagttgaagtccgcttatcagacttctctgtccactaatgatgtatcagaagctacacgctctccaacaaccggtcctcggcttcacacagccaagggtgccttgttaaagtcaaattccttcaacatgtataccaaagcaaaggttaaacttgtagacaacattgttcctcagaagcagaaggggtctaaagagcatggtactcttgatatgaaggagaggacagccagaatgatgggcaaatctgtgtcattcagatctcctgactcggggcgttccaatgtgtccgagtcaaaagttaaaatgctttcatcaaaatttaaccctcttcaagatctaaaaggaatgaaacaactaaaagagcggagcacagttgaaagaaaaaatttgtctaaactagaacgtcctccagttagtttgataacatcaagtgctattgtttcaacacctaaggctgaccaagcatcccgtggtgataccagtttgctttcatctgtgagcaaccttcgagagcataaggctcagctatctgatggaaaattaaatacgtcatcaaaagcaataagtagtctaactcgtaaaggtgttgaaactcaaagttctccaggtggttcttcacctattagtggaatgtgtagtgctgcttctgaagaaaagtcgaaccaagttatctctaacaatgaacctttatccagctattctcagcctgttgagaaagtacctgctgatgatgaagggaaattagaagatacacttcgatcatgggaaatgacaaatcagactgataaaaccagggagacctctgttcgcagtaggccgattgttgcagctagttcaaaaagtcttttctgttcaatttgtaaggagattggtcatactgctgaatcttgcaaaagcgggatttcacaggctagtgttactgatgtttctcctccaagaagttacagggaggaggtgccaagagatagtaggttgaaagatgcaattcacgcagctttgcttagaaagcctgaaatatacaaaaagaaaacattgccagatcaatctgatgaattgtccgcatccaacatggaatcaagttctgaagtagcttctccagagtttgtatcaaatatgttgaataataacacatatactgaaggatcacatgatggagaagcaattcctgggagttctacttccgatttctacaagaatacattacagcccgctaattctgtgattccttccagggtggtagactctggttctgttcttccttcttttgggaagtcaacaatgagagatttgcagagacaggcttcagtggggatgtctgttcttatgaagacaacagccattccagaatatgaatacatctggcaggggagctttgaactgcaaagaggtggaaatattctggatctatgcggtggcattcaagctcatttatcgacttgtgcatcaccaaaagtacttgaagtggtgaacaaatttccgcacaaagttcctctgaaagaagtacctcgtttatgtgtatggccagcacaatttcatcaaagtggtgttagagaggacaatatagcactttacttctttgccaaagatcttgagagttatgaaaggaactacaagatccttatagatgcaatgatcaagaatgatttagccctcaaaggaaggtttggtggggttgaacttctgatactcccttcaaatcagcttcctgagaaatcacaacgttggaatatgctttatttcttatggggtgtgttcagggagacaagggtgcattacatagattctactagaaaattagatgttcctggcttgaatgatgtctcattggacaatgacactcccactgtgatggctttatccaagaacctgcacgttcccgagcatataggtgcagctgacaggttgtctggtgcagcctctgcatccaagtccccagagcctgtggttcttacggttagcaaggatcttgagagcaaagatacgtatccggaagagatgtgttttggttcaaaagagaacttggtgctacaggatagtagggttgactccgaatacacaacaaacaatgcaggcttgtctggaggagttaaacgcaccactccttcactgcaagaagtttgccttcgagagagcagactagacaccgtagggcctgttggtatggagagaattgcagatagaaagaacatggttggtatcccaggaggtgatgaggaggtgattttggaaaaagtgaaaatagacagggatgaatttaaacaagtgaaggagctgaagagagaggatggatctaaagaaatggaaacagcttttgtgagagacttgacaacaagagtcaactcttgtcagtctaataatagaatacatccccatatagatctgtcagagccagcagcttcttccaccacaaatcaagaaatgccatggaatgttgtgaatactatgcaaagagatggacagagtgatagtaagaagccaaaactagatactagtgaactacatggttttagtacttcaaagtctgttctttctacttcagaagaggagatgaattttcctgaagcatgtgatgaaaaagttattccagaggacttgggaactactgaaaggcacttctttcctgtggaatcaaggaatgtccaggattttcagatggacaacaactctctgccatggaaaaatttctcgtcaggaaatgaggataagtctgacgggtttccaagtctcgagcttgctctcagggcagaaacaaaaccaccaagtaagggaaatctgcctttctttgtcgggttaggtggtgagagagataaccaggataggtctttagtaaaaacacttggtgagaaagaggatgatgtctctgcttcactttcactctctctttctttccccttcccagacaaggaacaacctgtgaaacctgttacaaaatctgagcaacttctgcctgaaaggcaccacgtgaatacatcactgcttctgtttgggcgctttccagaaaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1391

Amino Acids

153.09

Weight (kDa)

5.98

Isoelectric Point (pI)

49.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000769)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G02890 AT3G02890 AT3G02890 AT3G02890 AT5G16680 AT5G16680
fragaria_vesca FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220 FvH4_7g34220
malus_domestica MD01G1238900.v1.1 MD07G1310800.v1.1
prunus_persica Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1 Prupe.2G329000_v2.0.a1
pyrus_communis pycom01g24640 pycom07g28310
rosa_chinensis RchiOBHm_Chr1g0384581
rosa_laevigata RLG00000026030
rosa_multiflora Rmu_sc0006005.1_g000016
rosa_roxburghii Rroxscaffold_4G00276570
rosa_rugosa Rorug01G0449400 Rorug01G0449500
rosa_samantha Rh1AG474300 Rh1BG432300 Rh1CG445500 Rh1DG464900
rosa_wichuraiana Rw1G039830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 582
AasI GACNNNNNNGTC 1 cut(s) 1198
Acc36I ACCTGC 3 cut(s) 812, 1900, 3045
AccB1I GGYRCC 3 cut(s) 1268, 2125, 4125
AccB7I CCANNNNNTGG 1 cut(s) 482
AccBSI CCGCTC 1 cut(s) 1534
AccI GTMKAC 3 cut(s) 1301, 1326, 2409
AccIII TCCGGA 1 cut(s) 3157
AclI AACGTT 1 cut(s) 2890
AclWI GGATC 6 cut(s) 1102, 2320, 2580, 2779, 3141, 3466
AcoI YGGCCR 2 cut(s) 643, 2690
AcuI CTGAAG 9 cut(s) 381, 438, 1839, 2274, 2328, 2457, 3464, 3690, 3750
AcvI CACGTG 2 cut(s) 1139, 4132
AdeI CACNNNGTG 2 cut(s) 4010, 4132
AfaI GTAC 6 cut(s) 1012, 1372, 1890, 2625, 2673, 3682
AfiI CCNNNNNNNGG 8 cut(s) 482, 1241, 1248, 1439, 1796, 2435, 3935, 4072
AflIII ACRYGT 1 cut(s) 1296
AgeI ACCGGT 1 cut(s) 1241
AhdI GACNNNNNGTC 1 cut(s) 3073
AhlI ACTAGT 1 cut(s) 3659
AjiI CACGTC 1 cut(s) 1034
AjnI CCWGG 8 cut(s) 1774, 1961, 2335, 2399, 2974, 3370, 3810, 3981
AjuI GAANNNNNNNTTGG 2 cut(s) 431, 463
AloI GAACNNNNNNTCC 2 cut(s) 926, 958
Alw21I GWGCWC 2 cut(s) 205, 1541
AlwI GGATC 6 cut(s) 1102, 2320, 2580, 2779, 3141, 3466
AlwNI CAGNNNCTG 2 cut(s) 3089, 3110
Ama87I CYCGRG 4 cut(s) 1086, 1438, 3047, 3896
Aor13HI TCCGGA 1 cut(s) 3157
AoxI GGCC 6 cut(s) 412, 594, 643, 1985, 2690, 3320
AsiGI ACCGGT 1 cut(s) 1241
Asp700I GAANNNNTTC 2 cut(s) 2331, 3851
AspLEI GCGC 2 cut(s) 722, 4161
AspS9I GGNCC 3 cut(s) 413, 1244, 3320
AvaI CYCGRG 4 cut(s) 1086, 1438, 3047, 3896
AvaII GGWCC 1 cut(s) 1244
AxyI CCTNAGG 2 cut(s) 209, 1620
BalI TGGCCA 2 cut(s) 645, 2692
BanI GGYRCC 3 cut(s) 1268, 2125, 4125
BarI GAAGNNNNNNTAC 4 cut(s) 379, 411, 1798, 1830
BbrPI CACGTG 2 cut(s) 1139, 4132
BbsI GAAGAC 4 cut(s) 81, 439, 1137, 2504
Bbv12I GWGCWC 2 cut(s) 205, 1541
BciT130I CCWGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
BciVI GTATCC 2 cut(s) 3165, 3377
BclI TGATCA 1 cut(s) 2802
BcuI ACTAGT 1 cut(s) 3659
BfaI CTAG 9 cut(s) 561, 705, 1568, 2001, 2082, 2958, 3308, 3653, 3660
BfmI CTRYAG 1 cut(s) 3197
BfoI RGCGCY 1 cut(s) 4162
BfuAI ACCTGC 3 cut(s) 812, 1900, 3045
BfuI GTATCC 2 cut(s) 3165, 3377
BglI GCCNNNNNGGC 1 cut(s) 4123
BglII AGATCT 4 cut(s) 1427, 1504, 2755, 3547
BlpI GCTNAGC 1 cut(s) 1692
BmcAI AGTACT 2 cut(s) 2625, 3682
Bme1390I CCNGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
Bme18I GGWCC 1 cut(s) 1244
BmeRI GACNNNNNGTC 1 cut(s) 3073
BmeT110I CYCGRG 4 cut(s) 1086, 1438, 3047, 3896
BmgBI CACGTC 1 cut(s) 1034
BmgT120I GGNCC 3 cut(s) 413, 1244, 3320
BmiI GGNNCC 4 cut(s) 1056, 1270, 2127, 4127
BmrFI CCNGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
BmsI GCATC 7 cut(s) 845, 1643, 2140, 2240, 2621, 2785, 3101
BoxI GACNNNNGTC 1 cut(s) 822
BpiI GAAGAC 4 cut(s) 81, 439, 1137, 2504
BpmI CTGGAG 4 cut(s) 1563, 1758, 2250, 3270
Bpu1102I GCTNAGC 1 cut(s) 1692
BpuEI CTTGAG 4 cut(s) 1027, 1100, 2780, 3158
BsaAI YACGTR 3 cut(s) 1139, 3153, 4132
BsaBI GATNNNNATC 1 cut(s) 3153
BsaI GGTCTC 2 cut(s) 623, 1961
BsaJI CCNNGG 9 cut(s) 1247, 1263, 1639, 1962, 2336, 2400, 3370, 3593, 3842
BsaWI WCCGGW 2 cut(s) 1241, 3157
BsaXI ACNNNNNCTCC 2 cut(s) 1216, 1246
Bsc4I CCNNNNNNNGG 8 cut(s) 482, 1241, 1248, 1439, 1796, 2435, 3935, 4072
Bse118I RCCGGY 1 cut(s) 1241
Bse1I ACTGG 5 cut(s) 132, 633, 926, 1580, 1650
Bse21I CCTNAGG 2 cut(s) 209, 1620
Bse3DI GCAATG 2 cut(s) 2201, 2805
Bse8I GATNNNNATC 1 cut(s) 3153
BseAI TCCGGA 1 cut(s) 3157
BseBI CCWGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
BseDI CCNNGG 9 cut(s) 1247, 1263, 1639, 1962, 2336, 2400, 3370, 3593, 3842
BseGI GGATG 8 cut(s) 1634, 2231, 2487, 3092, 3424, 3460, 3535, 4027
BseJI GATNNNNATC 1 cut(s) 3153
BseLI CCNNNNNNNGG 8 cut(s) 482, 1241, 1248, 1439, 1796, 2435, 3935, 4072
BseMI GCAATG 2 cut(s) 2201, 2805
BseMII CTCAG 7 cut(s) 939, 1355, 1706, 1886, 2868, 3922, 4095
BseNI ACTGG 5 cut(s) 132, 633, 926, 1580, 1650
BseRI GAGGAG 6 cut(s) 1047, 2091, 2135, 3267, 3398, 3728
BseYI CCCAGC 2 cut(s) 1014, 1109
BsgI GTGCAG 5 cut(s) 888, 1056, 3023, 3081, 3102
BshFI GGCC 6 cut(s) 414, 596, 645, 1987, 2692, 3322
BshNI GGYRCC 3 cut(s) 1268, 2125, 4125
BshTI ACCGGT 1 cut(s) 1241
BsiHKAI GWGCWC 2 cut(s) 205, 1541
BsiHKCI CYCGRG 4 cut(s) 1086, 1438, 3047, 3896
BsiSI CCGG 2 cut(s) 1242, 3158
BslFI GGGAC 2 cut(s) 830, 3085
BslI CCNNNNNNNGG 8 cut(s) 482, 1241, 1248, 1439, 1796, 2435, 3935, 4072
BsmBI CGTCTC 1 cut(s) 1024
BsmFI GGGAC 2 cut(s) 830, 3085
BsmI GAATGC 3 cut(s) 341, 941, 2586
BsnI GGCC 6 cut(s) 414, 596, 645, 1987, 2692, 3322
Bso31I GGTCTC 2 cut(s) 623, 1961
BsoBI CYCGRG 4 cut(s) 1086, 1438, 3047, 3896
Bsp1286I GDGCHC 2 cut(s) 205, 1541
Bsp13I TCCGGA 1 cut(s) 3157
Bsp1720I GCTNAGC 1 cut(s) 1692
Bsp19I CCATGG 2 cut(s) 3593, 3842
BspANI GGCC 6 cut(s) 414, 596, 645, 1987, 2692, 3322
BspCNI CTCAG 7 cut(s) 940, 1354, 1705, 1885, 2869, 3921, 4096
BspEI TCCGGA 1 cut(s) 3157
BspHI TCATGA 1 cut(s) 292
BspLI GGNNCC 4 cut(s) 1056, 1270, 2127, 4127
BspMI ACCTGC 3 cut(s) 812, 1900, 3045
BspPI GGATC 6 cut(s) 1102, 2320, 2580, 2779, 3141, 3466
BspT107I GGYRCC 3 cut(s) 1268, 2125, 4125
BspTNI GGTCTC 2 cut(s) 623, 1961
BsrBI CCGCTC 1 cut(s) 1534
BsrDI GCAATG 2 cut(s) 2201, 2805
BsrFI RCCGGY 1 cut(s) 1241
BsrI ACTGG 5 cut(s) 132, 633, 926, 1580, 1650
BssAI RCCGGY 1 cut(s) 1241
BssECI CCNNGG 9 cut(s) 1247, 1263, 1639, 1962, 2336, 2400, 3370, 3593, 3842
BssNAI GTATAC 1 cut(s) 1302
BssT1I CCWWGG 3 cut(s) 1263, 3593, 3842
Bst1107I GTATAC 1 cut(s) 1302
Bst2UI CCWGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
Bst4CI ACNGT 8 cut(s) 116, 764, 866, 1126, 1543, 3016, 3124, 3316
Bst6I CTCTTC 4 cut(s) 1503, 3156, 3440, 3705
BstAPI GCANNNNNTGC 3 cut(s) 739, 3089, 4114
BstBAI YACGTR 3 cut(s) 1139, 3153, 4132
BstC8I GCNNGC 7 cut(s) 840, 887, 2379, 2694, 3241, 3561, 3903
BstDSI CCRYGG 3 cut(s) 1639, 3593, 3842
BstF5I GGATG 8 cut(s) 1634, 2231, 2487, 3092, 3424, 3460, 3535, 4027
BstH2I RGCGCY 1 cut(s) 4162
BstHHI GCGC 2 cut(s) 722, 4161
BstNI CCWGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
BstNSI RCATGY 4 cut(s) 111, 889, 1300, 3738
BstPAI GACNNNNGTC 1 cut(s) 822
BstSCI CCNGG 8 cut(s) 1774, 1961, 2335, 2399, 2974, 3370, 3810, 3981
BstSFI CTRYAG 1 cut(s) 3197
BstSNI TACGTA 1 cut(s) 3153
BstV2I GAAGAC 4 cut(s) 81, 439, 1137, 2504
BstX2I RGATCY 8 cut(s) 1427, 1504, 2572, 2755, 2784, 3133, 3458, 3547
BstXI CCANNNNNNTGG 2 cut(s) 1405, 3019
BstYI RGATCY 8 cut(s) 1427, 1504, 2572, 2755, 2784, 3133, 3458, 3547
BstZ17I GTATAC 1 cut(s) 1302
Bsu36I CCTNAGG 2 cut(s) 209, 1620
BsuI GTATCC 2 cut(s) 3165, 3377
BsuRI GGCC 6 cut(s) 414, 596, 645, 1987, 2692, 3322
BtgI CCRYGG 3 cut(s) 1639, 3593, 3842
BtrI CACGTC 1 cut(s) 1034
BtsCI GGATG 8 cut(s) 1634, 2231, 2487, 3092, 3424, 3460, 3535, 4027
BtsI GCAGTG 3 cut(s) 493, 3275, 4142
BveI ACCTGC 3 cut(s) 812, 1900, 3045
Cac8I GCNNGC 7 cut(s) 840, 887, 2379, 2694, 3241, 3561, 3903
CaiI CAGNNNCTG 2 cut(s) 3089, 3110
CciI TCATGA 1 cut(s) 292
CfoI GCGC 2 cut(s) 722, 4161
Cfr10I RCCGGY 1 cut(s) 1241
Cfr13I GGNCC 3 cut(s) 413, 1244, 3320
CseI GACGC 1 cut(s) 827
Csp6I GTAC 6 cut(s) 1011, 1371, 1889, 2624, 2672, 3681
CspAI ACCGGT 1 cut(s) 1241
CviQI GTAC 6 cut(s) 1011, 1371, 1889, 2624, 2672, 3681
DraI TTTAAA 1 cut(s) 3427
DraIII CACNNNGTG 2 cut(s) 4010, 4132
DrdI GACNNNNNNGTC 1 cut(s) 1198
DriI GACNNNNNGTC 1 cut(s) 3073
DseDI GACNNNNNNGTC 1 cut(s) 1198
EaeI YGGCCR 2 cut(s) 643, 2690
Eam1104I CTCTTC 4 cut(s) 1503, 3156, 3440, 3705
Eam1105I GACNNNNNGTC 1 cut(s) 3073
EarI CTCTTC 4 cut(s) 1503, 3156, 3440, 3705
Eco105I TACGTA 1 cut(s) 3153
Eco130I CCWWGG 3 cut(s) 1263, 3593, 3842
Eco147I AGGCCT 1 cut(s) 596
Eco31I GGTCTC 2 cut(s) 623, 1961
Eco47I GGWCC 1 cut(s) 1244
Eco57I CTGAAG 9 cut(s) 381, 438, 1839, 2274, 2328, 2457, 3464, 3690, 3750
Eco72I CACGTG 2 cut(s) 1139, 4132
Eco81I CCTNAGG 2 cut(s) 209, 1620
Eco88I CYCGRG 4 cut(s) 1086, 1438, 3047, 3896
EcoO109I RGGNCCY 2 cut(s) 413, 3320
EcoRI GAATTC 1 cut(s) 515
EcoRII CCWGG 8 cut(s) 1774, 1961, 2335, 2399, 2974, 3370, 3810, 3981
EcoT14I CCWWGG 3 cut(s) 1263, 3593, 3842
ErhI CCWWGG 3 cut(s) 1263, 3593, 3842
Esp3I CGTCTC 1 cut(s) 1024
FalI AAGNNNNNCTT 8 cut(s) 822, 854, 1256, 1288, 1908, 1940, 3276, 3308
FaqI GGGAC 2 cut(s) 830, 3085
FauI CCCGC 3 cut(s) 41, 2060, 2386
FbaI TGATCA 1 cut(s) 2802
FblI GTMKAC 3 cut(s) 1301, 1326, 2409
FokI GGATG 8 cut(s) 1621, 2218, 2494, 3079, 3431, 3467, 3522, 4034
FspBI CTAG 9 cut(s) 561, 705, 1568, 2001, 2082, 2958, 3308, 3653, 3660
GlaI GCGC 2 cut(s) 721, 4160
GsaI CCCAGC 2 cut(s) 1018, 1113
GsuI CTGGAG 4 cut(s) 1563, 1758, 2250, 3270
HaeII RGCGCY 1 cut(s) 4162
HaeIII GGCC 6 cut(s) 414, 596, 645, 1987, 2692, 3322
HapII CCGG 2 cut(s) 1242, 3158
HgaI GACGC 1 cut(s) 827
HhaI GCGC 2 cut(s) 722, 4161
Hin6I GCGC 2 cut(s) 720, 4159
HinP1I GCGC 2 cut(s) 720, 4159
HincII GTYRAC 3 cut(s) 2445, 3214, 3508
HindII GTYRAC 3 cut(s) 2445, 3214, 3508
HindIII AAGCTT 1 cut(s) 663
HpaII CCGG 2 cut(s) 1242, 3158
Hpy99I CGWCG 1 cut(s) 866
HpyCH4III ACNGT 8 cut(s) 116, 764, 866, 1126, 1543, 3016, 3124, 3316
HpyCH4IV ACGT 8 cut(s) 1033, 1138, 1573, 1718, 2890, 3042, 3152, 4131
HpySE526I ACGT 8 cut(s) 1033, 1138, 1573, 1718, 2890, 3042, 3152, 4131
HspAI GCGC 2 cut(s) 720, 4159
Kpn2I TCCGGA 1 cut(s) 3157
Ksp22I TGATCA 1 cut(s) 2802
LmnI GCTCC 5 cut(s) 784, 1060, 1536, 2538, 3439
LweI GCATC 7 cut(s) 845, 1643, 2140, 2240, 2621, 2785, 3101
MaeI CTAG 9 cut(s) 561, 705, 1568, 2001, 2082, 2958, 3308, 3653, 3660
MaeII ACGT 8 cut(s) 1033, 1138, 1573, 1718, 2890, 3042, 3152, 4131
MaeIII GTNAC 6 cut(s) 110, 143, 917, 2086, 2111, 4093
MbiI CCGCTC 1 cut(s) 1534
MflI RGATCY 8 cut(s) 1427, 1504, 2572, 2755, 2784, 3133, 3458, 3547
MhlI GDGCHC 2 cut(s) 205, 1541
MlsI TGGCCA 2 cut(s) 645, 2692
MluNI TGGCCA 2 cut(s) 645, 2692
MmeI TCCRAC 3 cut(s) 1259, 2259, 2873
Mox20I TGGCCA 2 cut(s) 645, 2692
MroI TCCGGA 1 cut(s) 3157
MroXI GAANNNNTTC 2 cut(s) 2331, 3851
MscI TGGCCA 2 cut(s) 645, 2692
MseI TTAA 9 cut(s) 542, 699, 1277, 1317, 1470, 1491, 1712, 3258, 3426
MslI CAYNNNNRTG 3 cut(s) 2709, 3017, 3057
Msp20I TGGCCA 2 cut(s) 645, 2692
MspA1I CMGCKG 2 cut(s) 725, 3065
MspI CCGG 2 cut(s) 1242, 3158
MspR9I CCNGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
Mva1269I GAATGC 3 cut(s) 341, 941, 2586
MvaI CCWGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
NcoI CCATGG 2 cut(s) 3593, 3842
NlaIV GGNNCC 4 cut(s) 1056, 1270, 2127, 4127
NmeAIII GCCGAG 1 cut(s) 1228
NmuCI GTSAC 2 cut(s) 110, 917
NspI RCATGY 4 cut(s) 111, 889, 1300, 3738
PaeI GCATGC 1 cut(s) 889
PaeR7I CTCGAG 1 cut(s) 3896
PagI TCATGA 1 cut(s) 292
PceI AGGCCT 1 cut(s) 596
PciI ACATGT 1 cut(s) 1296
PctI GAATGC 3 cut(s) 341, 941, 2586
PdmI GAANNNNTTC 2 cut(s) 2331, 3851
PflMI CCANNNNNTGG 1 cut(s) 482
PfoI TCCNGGA 1 cut(s) 3810
PinAI ACCGGT 1 cut(s) 1241
PmaCI CACGTG 2 cut(s) 1139, 4132
PmlI CACGTG 2 cut(s) 1139, 4132
Ppu21I YACGTR 3 cut(s) 1139, 3153, 4132
PscI ACATGT 1 cut(s) 1296
PshAI GACNNNNGTC 1 cut(s) 822
PsiI TTATAA 1 cut(s) 582
Psp1406I AACGTT 1 cut(s) 2890
Psp6I CCWGG 8 cut(s) 1774, 1961, 2335, 2399, 2974, 3370, 3810, 3981
PspCI CACGTG 2 cut(s) 1139, 4132
PspFI CCCAGC 2 cut(s) 1014, 1109
PspGI CCWGG 8 cut(s) 1774, 1961, 2335, 2399, 2974, 3370, 3810, 3981
PspN4I GGNNCC 4 cut(s) 1056, 1270, 2127, 4127
PspPI GGNCC 3 cut(s) 413, 1244, 3320
PsrI GAACNNNNNNTAC 2 cut(s) 2838, 2870
PstNI CAGNNNCTG 2 cut(s) 3089, 3110
PsuI RGATCY 8 cut(s) 1427, 1504, 2572, 2755, 2784, 3133, 3458, 3547
PvuII CAGCTG 2 cut(s) 725, 3065
RsaI GTAC 6 cut(s) 1012, 1372, 1890, 2625, 2673, 3682
RsaNI GTAC 6 cut(s) 1011, 1371, 1889, 2624, 2672, 3681
RseI CAYNNNNRTG 3 cut(s) 2709, 3017, 3057
SaqAI TTAA 9 cut(s) 542, 699, 1277, 1317, 1470, 1491, 1712, 3258, 3426
Sau96I GGNCC 3 cut(s) 413, 1244, 3320
ScaI AGTACT 2 cut(s) 2625, 3682
ScrFI CCNGG 8 cut(s) 1776, 1963, 2337, 2401, 2976, 3372, 3812, 3983
SduI GDGCHC 2 cut(s) 205, 1541
SfaNI GCATC 7 cut(s) 845, 1643, 2140, 2240, 2621, 2785, 3101
SfcI CTRYAG 1 cut(s) 3197
Sfr274I CTCGAG 1 cut(s) 3896
SinI GGWCC 1 cut(s) 1244
SlaI CTCGAG 1 cut(s) 3896
SmiMI CAYNNNNRTG 3 cut(s) 2709, 3017, 3057
SmlI CTYRAG 5 cut(s) 1006, 1079, 2759, 3137, 3896
SmoI CTYRAG 5 cut(s) 1006, 1079, 2759, 3137, 3896
SnaBI TACGTA 1 cut(s) 3153
SpeI ACTAGT 1 cut(s) 3659
SphI GCATGC 1 cut(s) 889
SseBI AGGCCT 1 cut(s) 596
SspI AATATT 1 cut(s) 2566
SspMI CTAG 9 cut(s) 561, 705, 1568, 2001, 2082, 2958, 3308, 3653, 3660
StuI AGGCCT 1 cut(s) 596
StyD4I CCNGG 8 cut(s) 1774, 1961, 2335, 2399, 2974, 3370, 3810, 3981
StyI CCWWGG 3 cut(s) 1263, 3593, 3842
TaaI ACNGT 8 cut(s) 116, 764, 866, 1126, 1543, 3016, 3124, 3316
TaiI ACGT 8 cut(s) 1036, 1141, 1576, 1721, 2893, 3045, 3155, 4134
TaqI TCGA 8 cut(s) 164, 497, 1678, 1829, 1927, 2603, 3295, 3897
TatI WGTACW 2 cut(s) 2623, 3680
TauI GCSGC 2 cut(s) 1055, 1108
Tru1I TTAA 9 cut(s) 542, 699, 1277, 1317, 1470, 1491, 1712, 3258, 3426
Tru9I TTAA 9 cut(s) 542, 699, 1277, 1317, 1470, 1491, 1712, 3258, 3426
TseFI GTSAC 2 cut(s) 110, 917
Tsp45I GTSAC 2 cut(s) 110, 917
TspGWI ACGGA 1 cut(s) 736
Van91I CCANNNNNTGG 1 cut(s) 482
VpaK11BI GGWCC 1 cut(s) 1244
XceI RCATGY 4 cut(s) 111, 889, 1300, 3738
XcmI CCANNNNNNNNNTGG 1 cut(s) 1637
XhoI CTCGAG 1 cut(s) 3896
XmiI GTMKAC 3 cut(s) 1301, 1326, 2409
XmnI GAANNNNTTC 2 cut(s) 2331, 3851
XspI CTAG 9 cut(s) 561, 705, 1568, 2001, 2082, 2958, 3308, 3653, 3660
ZrmI AGTACT 2 cut(s) 2625, 3682
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.