Rmu_sc0006031.1_g000002

Red chlorophyll catabolite reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006031.1
Physical Location & Seq
Reverse (-)
11177 .. 12633
1457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006031.1_g000002.1.cds

Sequence Viewer

Length: 930 bp
atggctgtcctcttccgccacattttccagtctccaccaccatcctcctccgcttctctaccttcatccaaaccaaggccattcttctgctccgcatcagcgtcatcctccatggagccgcacccaacaaagttcatggagttcccctacgtctcaacccctcacaagaacctcatggttcatcttgtatccaccgtcgagacgcgcctcgcctcccacctccttccttcaactctcccaccagacgtacaatactaccagaacgacaccgccactaaccatgcgtctcttcacatcagatccggccttccctcctcccctattgatttcatactaggaagttggctgcactgtcagctaccaacaggtggagcattgaacattacaagtttttcatcctatctcaacccatcaactgatgcacctaatttcctactcgagttgatccaaagcagtccgacttcactagtcctcatcctggacttgccttctcgaaaagaccttgttctccacccagactacctcaaaacattttatgaggatacaaagctggacagcccaaggcaaaagctcgagaaactagctgaggtgaaaccttacttctcctcatcgctttacatccgcagcgttgtgtcgcctaccgcaattttggttcgtgtagaagcagtagagggagggctaagcttagaggagatcatagagaaccatatcggtccggttgcaagggaagtgttgggcatctggttggaacaatgcgctcttgggaagagagaagtaggggagaatgagaaagctgaactgaagaagagggatgatttggttaagagaaagactattgagattgatctgggctcgaattttcctagattgtttggacctgatgctgcagatcgagtattgggagccattcgtgaagcttatagggtatga

Protein Analysis

309

Amino Acids

34.29

Weight (kDa)

6.37

Isoelectric Point (pI)

56.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 368
AccII CGCG 1 cut(s) 205
AciI CCGC 7 cut(s) 16, 51, 93, 119, 270, 622, 642
AclWI GGATC 2 cut(s) 294, 439
AcsI RAATTY 1 cut(s) 856
AcuI CTGAAG 1 cut(s) 821
AfaI GTAC 1 cut(s) 249
AfiI CCNNNNNNNGG 3 cut(s) 75, 368, 478
AgsI TTSAA 2 cut(s) 231, 379
AhlI ACTAGT 1 cut(s) 466
AjnI CCWGG 1 cut(s) 477
AluBI AGCT 7 cut(s) 358, 550, 571, 584, 684, 794, 917
AluI AGCT 7 cut(s) 358, 550, 571, 584, 684, 794, 917
Alw26I GTCTC 4 cut(s) 36, 157, 194, 291
AlwI GGATC 2 cut(s) 294, 439
Ama87I CYCGRG 2 cut(s) 437, 572
AoxI GGCC 2 cut(s) 77, 304
ApeKI GCWGC 3 cut(s) 346, 624, 884
ApoI RAATTY 1 cut(s) 856
AspLEI GCGC 2 cut(s) 207, 758
AspS9I GGNCC 2 cut(s) 713, 875
AsuHPI GGTGA 1 cut(s) 601
AvaI CYCGRG 2 cut(s) 437, 572
AvaII GGWCC 2 cut(s) 713, 875
BanII GRGCYC 1 cut(s) 854
BbvCI CCTCAGC 1 cut(s) 585
BbvI GCAGC 3 cut(s) 333, 636, 871
BccI CCATC 2 cut(s) 49, 418
BciT130I CCWGG 1 cut(s) 479
BciVI GTATCC 2 cut(s) 199, 535
BcoDI GTCTC 4 cut(s) 36, 157, 194, 291
BcuI ACTAGT 1 cut(s) 466
BfaI CTAG 4 cut(s) 335, 467, 581, 864
BfmI CTRYAG 1 cut(s) 885
BfuI GTATCC 2 cut(s) 199, 535
BisI GCNGC 4 cut(s) 119, 347, 625, 885
BlpI GCTNAGC 1 cut(s) 680
BlsI GCNGC 4 cut(s) 120, 348, 626, 886
Bme1390I CCNGG 1 cut(s) 479
Bme18I GGWCC 2 cut(s) 713, 875
BmeT110I CYCGRG 2 cut(s) 437, 572
BmgT120I GGNCC 2 cut(s) 713, 875
BmiI GGNNCC 2 cut(s) 117, 904
BmrFI CCNGG 1 cut(s) 479
BmsI GCATC 4 cut(s) 104, 409, 747, 871
Bpu10I CCTNAGC 1 cut(s) 585
Bpu1102I GCTNAGC 1 cut(s) 680
BsaJI CCNNGG 3 cut(s) 74, 111, 560
BsaWI WCCGGW 1 cut(s) 715
Bsc4I CCNNNNNNNGG 3 cut(s) 75, 368, 478
Bse1I ACTGG 1 cut(s) 28
BseBI CCWGG 1 cut(s) 479
BseDI CCNNGG 3 cut(s) 74, 111, 560
BseGI GGATG 7 cut(s) 41, 65, 104, 395, 474, 618, 817
BseLI CCNNNNNNNGG 3 cut(s) 75, 368, 478
BseMII CTCAG 1 cut(s) 576
BseNI ACTGG 1 cut(s) 28
BseRI GAGGAG 4 cut(s) 37, 304, 595, 704
BseXI GCAGC 3 cut(s) 333, 636, 871
BsgI GTGCAG 1 cut(s) 332
Bsh1236I CGCG 1 cut(s) 205
BshFI GGCC 2 cut(s) 79, 306
BsiHKCI CYCGRG 2 cut(s) 437, 572
BsiSI CCGG 2 cut(s) 303, 716
BslI CCNNNNNNNGG 3 cut(s) 75, 368, 478
BsmAI GTCTC 4 cut(s) 36, 157, 194, 291
BsmBI CGTCTC 3 cut(s) 157, 194, 291
BsnI GGCC 2 cut(s) 79, 306
BsoBI CYCGRG 2 cut(s) 437, 572
Bsp1286I GDGCHC 1 cut(s) 854
Bsp143I GATC 5 cut(s) 299, 444, 693, 844, 889
Bsp1720I GCTNAGC 1 cut(s) 680
Bsp19I CCATGG 1 cut(s) 111
BspACI CCGC 7 cut(s) 16, 51, 93, 119, 270, 622, 642
BspANI GGCC 2 cut(s) 79, 306
BspCNI CTCAG 1 cut(s) 577
BspFNI CGCG 1 cut(s) 205
BspLI GGNNCC 2 cut(s) 117, 904
BspMAI CTGCAG 1 cut(s) 889
BspPI GGATC 2 cut(s) 294, 439
BsrI ACTGG 1 cut(s) 28
BssECI CCNNGG 3 cut(s) 74, 111, 560
BssMI GATC 5 cut(s) 299, 444, 693, 844, 889
BssT1I CCWWGG 3 cut(s) 74, 111, 560
Bst2UI CCWGG 1 cut(s) 479
Bst4CI ACNGT 2 cut(s) 196, 353
Bst6I CTCTTC 4 cut(s) 17, 294, 761, 800
BstDEI CTNAG 3 cut(s) 585, 680, 685
BstDSI CCRYGG 1 cut(s) 111
BstF5I GGATG 7 cut(s) 41, 65, 104, 395, 474, 618, 817
BstFNI CGCG 1 cut(s) 205
BstHHI GCGC 2 cut(s) 207, 758
BstKTI GATC 5 cut(s) 302, 447, 696, 847, 892
BstMAI GTCTC 4 cut(s) 36, 157, 194, 291
BstMBI GATC 5 cut(s) 299, 444, 693, 844, 889
BstMWI GCNNNNNNNGC 1 cut(s) 355
BstNI CCWGG 1 cut(s) 479
BstSCI CCNGG 1 cut(s) 477
BstSFI CTRYAG 1 cut(s) 885
BstUI CGCG 1 cut(s) 205
BstV1I GCAGC 3 cut(s) 333, 636, 871
BstX2I RGATCY 1 cut(s) 299
BstYI RGATCY 1 cut(s) 299
BsuI GTATCC 2 cut(s) 199, 535
BsuRI GGCC 2 cut(s) 79, 306
BtgI CCRYGG 1 cut(s) 111
BtgZI GCGATG 1 cut(s) 594
BtsCI GGATG 7 cut(s) 41, 65, 104, 395, 474, 618, 817
BtsIMutI CAGTG 1 cut(s) 349
CfoI GCGC 2 cut(s) 207, 758
Cfr13I GGNCC 2 cut(s) 713, 875
CpoI CGGWCCG 1 cut(s) 713
CseI GACGC 3 cut(s) 90, 211, 273
Csp6I GTAC 1 cut(s) 248
CspI CGGWCCG 1 cut(s) 713
CviAII CATG 4 cut(s) 112, 136, 175, 281
CviQI GTAC 1 cut(s) 248
DdeI CTNAG 3 cut(s) 585, 680, 685
DpnI GATC 5 cut(s) 301, 446, 695, 846, 891
DpnII GATC 5 cut(s) 299, 444, 693, 844, 889
Eam1104I CTCTTC 4 cut(s) 17, 294, 761, 800
EarI CTCTTC 4 cut(s) 17, 294, 761, 800
EciI GGCGGA 1 cut(s) 5
Eco130I CCWWGG 3 cut(s) 74, 111, 560
Eco24I GRGCYC 1 cut(s) 854
Eco47I GGWCC 2 cut(s) 713, 875
Eco57I CTGAAG 1 cut(s) 821
Eco88I CYCGRG 2 cut(s) 437, 572
EcoRII CCWGG 1 cut(s) 477
EcoT14I CCWWGG 3 cut(s) 74, 111, 560
EcoT38I GRGCYC 1 cut(s) 854
ErhI CCWWGG 3 cut(s) 74, 111, 560
Esp3I CGTCTC 3 cut(s) 157, 194, 291
FaeI CATG 4 cut(s) 115, 139, 178, 284
FatI CATG 4 cut(s) 111, 135, 174, 280
Fnu4HI GCNGC 4 cut(s) 119, 347, 625, 885
FokI GGATG 7 cut(s) 28, 52, 91, 382, 461, 605, 824
FriOI GRGCYC 1 cut(s) 854
Fsp4HI GCNGC 4 cut(s) 119, 347, 625, 885
FspBI CTAG 4 cut(s) 335, 467, 581, 864
GlaI GCGC 2 cut(s) 206, 757
GluI GCNGC 4 cut(s) 119, 347, 625, 885
HaeIII GGCC 2 cut(s) 79, 306
HapII CCGG 2 cut(s) 303, 716
HgaI GACGC 3 cut(s) 90, 211, 273
HhaI GCGC 2 cut(s) 207, 758
Hin1II CATG 4 cut(s) 115, 139, 178, 284
Hin6I GCGC 2 cut(s) 205, 756
HinP1I GCGC 2 cut(s) 205, 756
HindIII AAGCTT 2 cut(s) 682, 915
HpaII CCGG 2 cut(s) 303, 716
HphI GGTGA 1 cut(s) 601
Hpy188I TCNGA 2 cut(s) 299, 459
Hpy188III TCNNGA 4 cut(s) 199, 492, 574, 911
Hpy99I CGWCG 1 cut(s) 200
HpyAV CCTTC 5 cut(s) 72, 233, 237, 317, 498
HpyCH4III ACNGT 2 cut(s) 196, 353
HpyCH4IV ACGT 2 cut(s) 150, 246
HpyCH4V TGCA 4 cut(s) 349, 422, 722, 887
HpyF10VI GCNNNNNNNGC 1 cut(s) 355
HpyF3I CTNAG 3 cut(s) 585, 680, 685
HpySE526I ACGT 2 cut(s) 150, 246
Hsp92II CATG 4 cut(s) 115, 139, 178, 284
HspAI GCGC 2 cut(s) 205, 756
Kzo9I GATC 5 cut(s) 299, 444, 693, 844, 889
LmnI GCTCC 4 cut(s) 95, 115, 371, 902
Lsp1109I GCAGC 3 cut(s) 333, 636, 871
LweI GCATC 4 cut(s) 104, 409, 747, 871
MaeI CTAG 4 cut(s) 335, 467, 581, 864
MaeII ACGT 2 cut(s) 150, 246
MalI GATC 5 cut(s) 301, 446, 695, 846, 891
MboI GATC 5 cut(s) 299, 444, 693, 844, 889
MboII GAAGA 6 cut(s) 4, 76, 281, 778, 814, 817
MflI RGATCY 1 cut(s) 299
MhlI GDGCHC 1 cut(s) 854
MluCI AATT 3 cut(s) 427, 645, 856
MmeI TCCRAC 2 cut(s) 482, 726
MseI TTAA 1 cut(s) 822
MspI CCGG 2 cut(s) 303, 716
MspR9I CCNGG 1 cut(s) 479
MvaI CCWGG 1 cut(s) 479
MvnI CGCG 1 cut(s) 205
MwoI GCNNNNNNNGC 1 cut(s) 355
NcoI CCATGG 1 cut(s) 111
NdeII GATC 5 cut(s) 299, 444, 693, 844, 889
NlaIII CATG 4 cut(s) 115, 139, 178, 284
NlaIV GGNNCC 2 cut(s) 117, 904
PaeR7I CTCGAG 2 cut(s) 437, 572
PflMI CCANNNNNTGG 1 cut(s) 368
PfoI TCCNGGA 1 cut(s) 477
PkrI GCNGC 4 cut(s) 120, 348, 626, 886
Psp6I CCWGG 1 cut(s) 477
PspGI CCWGG 1 cut(s) 477
PspN4I GGNNCC 2 cut(s) 117, 904
PspPI GGNCC 2 cut(s) 713, 875
PspXI VCTCGAGB 1 cut(s) 437
PstI CTGCAG 1 cut(s) 889
PsuI RGATCY 1 cut(s) 299
RsaI GTAC 1 cut(s) 249
RsaNI GTAC 1 cut(s) 248
Rsr2I CGGWCCG 1 cut(s) 713
RsrII CGGWCCG 1 cut(s) 713
SaqAI TTAA 1 cut(s) 822
SatI GCNGC 4 cut(s) 119, 347, 625, 885
Sau3AI GATC 5 cut(s) 299, 444, 693, 844, 889
Sau96I GGNCC 2 cut(s) 713, 875
ScrFI CCNGG 1 cut(s) 479
SduI GDGCHC 1 cut(s) 854
SfaNI GCATC 4 cut(s) 104, 409, 747, 871
SfcI CTRYAG 1 cut(s) 885
Sfr274I CTCGAG 2 cut(s) 437, 572
SinI GGWCC 2 cut(s) 713, 875
SlaI CTCGAG 2 cut(s) 437, 572
SmlI CTYRAG 2 cut(s) 437, 572
SmoI CTYRAG 2 cut(s) 437, 572
SpeI ACTAGT 1 cut(s) 466
Sse9I AATT 3 cut(s) 427, 645, 856
SsiI CCGC 7 cut(s) 16, 51, 93, 119, 270, 622, 642
SspMI CTAG 4 cut(s) 335, 467, 581, 864
StyD4I CCNGG 1 cut(s) 477
StyI CCWWGG 3 cut(s) 74, 111, 560
TaaI ACNGT 2 cut(s) 196, 353
TaiI ACGT 2 cut(s) 153, 249
TaqI TCGA 6 cut(s) 198, 438, 493, 573, 854, 892
TaqII GACCGA 1 cut(s) 701
TasI AATT 3 cut(s) 427, 645, 856
TauI GCSGC 1 cut(s) 121
Tru1I TTAA 1 cut(s) 822
Tru9I TTAA 1 cut(s) 822
TscAI CASTG 1 cut(s) 356
TseI GCWGC 3 cut(s) 346, 624, 884
TspDTI ATGAA 5 cut(s) 54, 124, 170, 319, 384
TspRI CASTG 1 cut(s) 356
Van91I CCANNNNNTGG 1 cut(s) 368
VpaK11BI GGWCC 2 cut(s) 713, 875
XapI RAATTY 1 cut(s) 856
XhoI CTCGAG 2 cut(s) 437, 572
XspI CTAG 4 cut(s) 335, 467, 581, 864
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.