Rmu_sc0006536.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006536.1
OG0005914
Physical Location & Seq
Reverse (-)
68497 .. 68730
234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006536.1_g000016.1.cds

Sequence Viewer

Length: 234 bp
atgggccaaatgcagactcgcattctccatgagcagcaaaatcttacgagccagttattggggattgtctctcagtggactgctcatccagctggactgtctgatcataccggtgcaagcaaccattatttatcacagatgatgcagaatttgcaccatgtgaatagtttggatcatgacgatgctagggttgatggagataatcaagatgaccagttcattgttgacggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.62

Weight (kDa)

4.87

Isoelectric Point (pI)

17.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 58
AclWI GGATC 1 cut(s) 180
AcsI RAATTY 1 cut(s) 148
AdeI CACNNNGTG 1 cut(s) 160
AfiI CCNNNNNNNGG 1 cut(s) 58
AgeI ACCGGT 1 cut(s) 110
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
Alw26I GTCTC 1 cut(s) 73
AlwI GGATC 1 cut(s) 180
AoxI GGCC 1 cut(s) 4
ApeKI GCWGC 1 cut(s) 34
ApoI RAATTY 1 cut(s) 148
AsiGI ACCGGT 1 cut(s) 110
AspS9I GGNCC 1 cut(s) 4
BbvI GCAGC 1 cut(s) 46
BccI CCATC 1 cut(s) 188
BclI TGATCA 1 cut(s) 103
BcoDI GTCTC 1 cut(s) 73
BfaI CTAG 1 cut(s) 186
BisI GCNGC 1 cut(s) 35
BlsI GCNGC 1 cut(s) 36
BmgT120I GGNCC 1 cut(s) 4
BmsI GCATC 2 cut(s) 132, 172
BsaWI WCCGGW 1 cut(s) 110
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse118I RCCGGY 1 cut(s) 110
Bse1I ACTGG 2 cut(s) 52, 214
BseGI GGATG 1 cut(s) 85
BseLI CCNNNNNNNGG 1 cut(s) 58
BseMII CTCAG 1 cut(s) 86
BseNI ACTGG 2 cut(s) 52, 214
BseXI GCAGC 1 cut(s) 46
BshFI GGCC 1 cut(s) 6
BshTI ACCGGT 1 cut(s) 110
BsiSI CCGG 1 cut(s) 111
BslI CCNNNNNNNGG 1 cut(s) 58
BsmAI GTCTC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 21
BsnI GGCC 1 cut(s) 6
Bsp143I GATC 2 cut(s) 103, 172
BspANI GGCC 1 cut(s) 6
BspCNI CTCAG 1 cut(s) 85
BspHI TCATGA 1 cut(s) 175
BspPI GGATC 1 cut(s) 180
BsrFI RCCGGY 1 cut(s) 110
BsrI ACTGG 2 cut(s) 52, 214
BssAI RCCGGY 1 cut(s) 110
BssMI GATC 2 cut(s) 103, 172
Bst4CI ACNGT 1 cut(s) 99
BstAPI GCANNNNNTGC 1 cut(s) 151
BstC8I GCNNGC 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 85
BstKTI GATC 2 cut(s) 106, 175
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 2 cut(s) 103, 172
BstMWI GCNNNNNNNGC 2 cut(s) 89, 151
BstV1I GCAGC 1 cut(s) 46
BsuRI GGCC 1 cut(s) 6
BtsCI GGATG 1 cut(s) 85
BtsIMutI CAGTG 1 cut(s) 80
Cac8I GCNNGC 1 cut(s) 118
CciI TCATGA 1 cut(s) 175
Cfr10I RCCGGY 1 cut(s) 110
Cfr13I GGNCC 1 cut(s) 4
CspAI ACCGGT 1 cut(s) 110
CviAII CATG 3 cut(s) 29, 158, 176
CviJI RGCY 3 cut(s) 6, 51, 92
CviKI_1 RGCY 3 cut(s) 6, 51, 92
DdeI CTNAG 1 cut(s) 72
DpnI GATC 2 cut(s) 105, 174
DpnII GATC 2 cut(s) 103, 172
DraIII CACNNNGTG 1 cut(s) 160
FaeI CATG 3 cut(s) 32, 161, 179
FaiI YATR 4 cut(s) 30, 108, 159, 177
FatI CATG 3 cut(s) 28, 157, 175
FbaI TGATCA 1 cut(s) 103
Fnu4HI GCNGC 1 cut(s) 35
FokI GGATG 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 35
FspBI CTAG 1 cut(s) 186
GluI GCNGC 1 cut(s) 35
HaeIII GGCC 1 cut(s) 6
HapII CCGG 1 cut(s) 111
Hin1II CATG 3 cut(s) 32, 161, 179
HincII GTYRAC 1 cut(s) 226
HindII GTYRAC 1 cut(s) 226
HinfI GANTC 1 cut(s) 16
HpaII CCGG 1 cut(s) 111
Hpy166II GTNNAC 2 cut(s) 78, 226
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 2 cut(s) 176, 206
Hpy8I GTNNAC 2 cut(s) 78, 226
HpyCH4III ACNGT 1 cut(s) 99
HpyCH4V TGCA 4 cut(s) 13, 116, 145, 154
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 151
HpyF3I CTNAG 1 cut(s) 72
Hsp92II CATG 3 cut(s) 32, 161, 179
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 2 cut(s) 103, 172
LpnPI CCDG 5 cut(s) 65, 78, 102, 124, 227
Lsp1109I GCAGC 1 cut(s) 46
LweI GCATC 2 cut(s) 132, 172
MaeI CTAG 1 cut(s) 186
MalI GATC 2 cut(s) 105, 174
MboI GATC 2 cut(s) 103, 172
MluCI AATT 1 cut(s) 148
MlyI GAGTC 1 cut(s) 10
MslI CAYNNNNRTG 2 cut(s) 111, 180
MspA1I CMGCKG 1 cut(s) 92
MspI CCGG 1 cut(s) 111
Mva1269I GAATGC 1 cut(s) 21
MwoI GCNNNNNNNGC 2 cut(s) 89, 151
NdeII GATC 2 cut(s) 103, 172
NlaIII CATG 3 cut(s) 32, 161, 179
PagI TCATGA 1 cut(s) 175
PctI GAATGC 1 cut(s) 21
PflMI CCANNNNNTGG 1 cut(s) 58
PinAI ACCGGT 1 cut(s) 110
PkrI GCNGC 1 cut(s) 36
PleI GAGTC 1 cut(s) 10
PpsI GAGTC 1 cut(s) 10
PspPI GGNCC 1 cut(s) 4
PvuII CAGCTG 1 cut(s) 92
RseI CAYNNNNRTG 2 cut(s) 111, 180
SatI GCNGC 1 cut(s) 35
Sau3AI GATC 2 cut(s) 103, 172
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 10
SetI ASST 1 cut(s) 94
SfaNI GCATC 2 cut(s) 132, 172
SmiMI CAYNNNNRTG 2 cut(s) 111, 180
Sse9I AATT 1 cut(s) 148
SspMI CTAG 1 cut(s) 186
TaaI ACNGT 1 cut(s) 99
TasI AATT 1 cut(s) 148
TscAI CASTG 1 cut(s) 80
TseI GCWGC 1 cut(s) 34
TspDTI ATGAA 1 cut(s) 208
TspRI CASTG 1 cut(s) 80
Van91I CCANNNNNTGG 1 cut(s) 58
XapI RAATTY 1 cut(s) 148
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.