Rmu_sc0006570.1_g000009

Belongs to the mitochondrial carrier (TC 2.A.29) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006570.1
Physical Location & Seq
Forward (+)
37805 .. 39807
2003 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006570.1_g000009.1.cds

Sequence Viewer

Length: 909 bp
atggatttctggccggaatttctcgcaagcagttggggcaaagaatttgtggcaggaggatgtggaggcattgctggtataatatctggttatccacttgacactcttaggattttgcaacagaattcaaagagcggctctgcctttaacattcttcgcaatgtcatctccaaagaaggccctgctgccctttacaggggcatggctgcccccttggcatccattacactccagaatgctatggttttccagtcatacgccattctctctcgggctctcgatccatcagtgtccactaaagatcctccttcttacaaaggtgttgctctaggagggttcggggcaggtgctttgcagagtctagtcctcagcccagtagaactcataaaaatccggcttcagctgcaaaccaaaacccaaaaggggccgagagaagttgccaaaagcattatgaaagcagaggggctaagaggattatatagaggcctgggcattactattcttagggatgcaccagctcatggtttgtacttttcaacttatgagtatatgagagagcagcttcatcccagctgtagaaaaaccggtgaagagagcatacaaacaatgttggtagctggagggctagcaggagttgctagctggatttgttgttatcccttggatgttgtaaagaccagattacaggctcaatctgcgtaccctccaccgaaatatactggcatagttgattgcttcagaaagagtgtgagagaggatggtcttgcggtcctctggcgaggactaggaactgctgttttgagagcgtttctggtgaatggttctatttttgcggcgtatgagattgctctgagatgccttcttagcaatggaagaattccaatagagaatgcaatgcctgaacagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

302

Amino Acids

32.64

Weight (kDa)

9.36

Isoelectric Point (pI)

43.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 335
Acc36I ACCTGC 1 cut(s) 335
AccB7I CCANNNNNTGG 1 cut(s) 521
AccBSI CCGCTC 1 cut(s) 135
AciI CCGC 3 cut(s) 135, 767, 833
AclWI GGATC 2 cut(s) 275, 296
AcoI YGGCCR 1 cut(s) 11
AcsI RAATTY 4 cut(s) 17, 44, 124, 876
AcuI CTGAAG 2 cut(s) 383, 721
AfaI GTAC 2 cut(s) 530, 701
AfiI CCNNNNNNNGG 4 cut(s) 195, 196, 423, 521
AgeI ACCGGT 1 cut(s) 584
AgsI TTSAA 2 cut(s) 129, 537
AjnI CCWGG 1 cut(s) 486
AluBI AGCT 6 cut(s) 403, 518, 562, 573, 617, 642
AluI AGCT 6 cut(s) 403, 518, 562, 573, 617, 642
AlwI GGATC 2 cut(s) 275, 296
Ama87I CYCGRG 1 cut(s) 270
AoxI GGCC 4 cut(s) 11, 178, 425, 484
ApeKI GCWGC 4 cut(s) 185, 206, 403, 559
ApoI RAATTY 4 cut(s) 17, 44, 124, 876
AsiGI ACCGGT 1 cut(s) 584
AspS9I GGNCC 3 cut(s) 179, 425, 769
AsuHPI GGTGA 2 cut(s) 599, 826
AsuNHI GCTAGC 2 cut(s) 625, 638
AvaI CYCGRG 1 cut(s) 270
AvaII GGWCC 1 cut(s) 769
BanII GRGCYC 1 cut(s) 277
BarI GAAGNNNNNNTAC 2 cut(s) 582, 614
BbvCI CCTCAGC 1 cut(s) 368
BbvI GCAGC 4 cut(s) 172, 193, 390, 571
BccI CCATC 2 cut(s) 292, 752
BciT130I CCWGG 1 cut(s) 488
BfaI CTAG 5 cut(s) 329, 362, 626, 639, 785
BfmI CTRYAG 1 cut(s) 574
BfuAI ACCTGC 1 cut(s) 335
BglI GCCNNNNNGGC 1 cut(s) 215
BisI GCNGC 6 cut(s) 136, 186, 207, 404, 560, 834
BlsI GCNGC 6 cut(s) 137, 187, 208, 405, 561, 835
Bme1390I CCNGG 1 cut(s) 488
Bme18I GGWCC 1 cut(s) 769
BmeT110I CYCGRG 1 cut(s) 270
BmgT120I GGNCC 3 cut(s) 179, 425, 769
BmiI GGNNCC 1 cut(s) 426
BmrFI CCNGG 1 cut(s) 488
BmrI ACTGGG 1 cut(s) 368
BmsI GCATC 3 cut(s) 227, 499, 845
BmtI GCTAGC 2 cut(s) 629, 642
BmuI ACTGGG 1 cut(s) 368
BpmI CTGGAG 2 cut(s) 215, 639
Bpu10I CCTNAGC 1 cut(s) 368
BsaJI CCNNGG 3 cut(s) 213, 487, 660
BsaWI WCCGGW 1 cut(s) 584
Bsc4I CCNNNNNNNGG 4 cut(s) 195, 196, 423, 521
Bse118I RCCGGY 1 cut(s) 584
Bse1I ACTGG 3 cut(s) 250, 374, 724
Bse3DI GCAATG 4 cut(s) 69, 166, 874, 900
BseBI CCWGG 1 cut(s) 488
BseDI CCNNGG 3 cut(s) 213, 487, 660
BseGI GGATG 6 cut(s) 65, 218, 514, 565, 670, 763
BseLI CCNNNNNNNGG 4 cut(s) 195, 196, 423, 521
BseMI GCAATG 4 cut(s) 69, 166, 874, 900
BseMII CTCAG 2 cut(s) 382, 842
BseNI ACTGG 3 cut(s) 250, 374, 724
BseXI GCAGC 4 cut(s) 172, 193, 390, 571
BseYI CCCAGC 1 cut(s) 569
BshFI GGCC 4 cut(s) 13, 180, 427, 486
BshTI ACCGGT 1 cut(s) 584
BsiHKCI CYCGRG 1 cut(s) 270
BsiSI CCGG 3 cut(s) 14, 394, 585
BslI CCNNNNNNNGG 4 cut(s) 195, 196, 423, 521
BsmI GAATGC 2 cut(s) 241, 895
BsnI GGCC 4 cut(s) 13, 180, 427, 486
BsoBI CYCGRG 1 cut(s) 270
Bsp1286I GDGCHC 1 cut(s) 277
Bsp143I GATC 2 cut(s) 280, 301
BspACI CCGC 3 cut(s) 135, 767, 833
BspANI GGCC 4 cut(s) 13, 180, 427, 486
BspCNI CTCAG 2 cut(s) 381, 843
BspLI GGNNCC 1 cut(s) 426
BspMI ACCTGC 1 cut(s) 335
BspOI GCTAGC 2 cut(s) 629, 642
BspPI GGATC 2 cut(s) 275, 296
BsrBI CCGCTC 1 cut(s) 135
BsrDI GCAATG 4 cut(s) 69, 166, 874, 900
BsrFI RCCGGY 1 cut(s) 584
BsrI ACTGG 3 cut(s) 250, 374, 724
BssAI RCCGGY 1 cut(s) 584
BssECI CCNNGG 3 cut(s) 213, 487, 660
BssMI GATC 2 cut(s) 280, 301
BssT1I CCWWGG 2 cut(s) 213, 660
Bst2UI CCWGG 1 cut(s) 488
Bst4CI ACNGT 1 cut(s) 906
Bst6I CTCTTC 1 cut(s) 585
BstAPI GCANNNNNTGC 1 cut(s) 635
BstC8I GCNNGC 3 cut(s) 28, 627, 640
BstDEI CTNAG 6 cut(s) 107, 368, 467, 503, 851, 863
BstF5I GGATG 6 cut(s) 65, 218, 514, 565, 670, 763
BstKTI GATC 2 cut(s) 283, 304
BstMBI GATC 2 cut(s) 280, 301
BstMWI GCNNNNNNNGC 6 cut(s) 36, 215, 403, 635, 695, 864
BstNI CCWGG 1 cut(s) 488
BstSCI CCNGG 1 cut(s) 486
BstSFI CTRYAG 1 cut(s) 574
BstV1I GCAGC 4 cut(s) 172, 193, 390, 571
BstX2I RGATCY 1 cut(s) 301
BstYI RGATCY 1 cut(s) 301
BsuRI GGCC 4 cut(s) 13, 180, 427, 486
BtsCI GGATG 6 cut(s) 65, 218, 514, 565, 670, 763
BtsIMutI CAGTG 1 cut(s) 294
BveI ACCTGC 1 cut(s) 335
Cac8I GCNNGC 3 cut(s) 28, 627, 640
Cfr10I RCCGGY 1 cut(s) 584
Cfr13I GGNCC 3 cut(s) 179, 425, 769
Csp6I GTAC 2 cut(s) 529, 700
CspAI ACCGGT 1 cut(s) 584
CviAII CATG 2 cut(s) 202, 521
CviQI GTAC 2 cut(s) 529, 700
DdeI CTNAG 6 cut(s) 107, 368, 467, 503, 851, 863
DpnI GATC 2 cut(s) 282, 303
DpnII GATC 2 cut(s) 280, 301
EaeI YGGCCR 1 cut(s) 11
Eam1104I CTCTTC 1 cut(s) 585
EarI CTCTTC 1 cut(s) 585
Eco130I CCWWGG 2 cut(s) 213, 660
Eco147I AGGCCT 1 cut(s) 486
Eco24I GRGCYC 1 cut(s) 277
Eco47I GGWCC 1 cut(s) 769
Eco57I CTGAAG 2 cut(s) 383, 721
Eco88I CYCGRG 1 cut(s) 270
EcoO109I RGGNCCY 1 cut(s) 179
EcoRI GAATTC 2 cut(s) 124, 876
EcoRII CCWGG 1 cut(s) 486
EcoT14I CCWWGG 2 cut(s) 213, 660
EcoT38I GRGCYC 1 cut(s) 277
ErhI CCWWGG 2 cut(s) 213, 660
FaeI CATG 2 cut(s) 205, 524
FatI CATG 2 cut(s) 201, 520
Fnu4HI GCNGC 6 cut(s) 136, 186, 207, 404, 560, 834
FokI GGATG 6 cut(s) 72, 205, 521, 552, 677, 770
FriOI GRGCYC 1 cut(s) 277
Fsp4HI GCNGC 6 cut(s) 136, 186, 207, 404, 560, 834
FspBI CTAG 5 cut(s) 329, 362, 626, 639, 785
GluI GCNGC 6 cut(s) 136, 186, 207, 404, 560, 834
GsaI CCCAGC 1 cut(s) 573
GsuI CTGGAG 2 cut(s) 215, 639
HaeIII GGCC 4 cut(s) 13, 180, 427, 486
HapII CCGG 3 cut(s) 14, 394, 585
Hin1II CATG 2 cut(s) 205, 524
HinfI GANTC 1 cut(s) 358
HpaII CCGG 3 cut(s) 14, 394, 585
HphI GGTGA 2 cut(s) 599, 826
Hpy166II GTNNAC 1 cut(s) 294
Hpy188I TCNGA 2 cut(s) 740, 852
Hpy188III TCNNGA 2 cut(s) 232, 278
Hpy8I GTNNAC 1 cut(s) 294
HpyAV CCTTC 3 cut(s) 170, 318, 869
HpyCH4III ACNGT 1 cut(s) 906
HpyCH4V TGCA 5 cut(s) 118, 355, 406, 512, 893
HpyF10VI GCNNNNNNNGC 6 cut(s) 36, 215, 403, 635, 695, 864
HpyF3I CTNAG 6 cut(s) 107, 368, 467, 503, 851, 863
Hsp92II CATG 2 cut(s) 205, 524
Kzo9I GATC 2 cut(s) 280, 301
Lsp1109I GCAGC 4 cut(s) 172, 193, 390, 571
LweI GCATC 3 cut(s) 227, 499, 845
MaeI CTAG 5 cut(s) 329, 362, 626, 639, 785
MalI GATC 2 cut(s) 282, 303
MbiI CCGCTC 1 cut(s) 135
MboI GATC 2 cut(s) 280, 301
MboII GAAGA 3 cut(s) 146, 602, 885
MflI RGATCY 1 cut(s) 301
MhlI GDGCHC 1 cut(s) 277
MluCI AATT 4 cut(s) 17, 44, 124, 876
MlyI GAGTC 1 cut(s) 367
MseI TTAA 1 cut(s) 147
MspA1I CMGCKG 2 cut(s) 403, 573
MspI CCGG 3 cut(s) 14, 394, 585
MspR9I CCNGG 1 cut(s) 488
Mva1269I GAATGC 2 cut(s) 241, 895
MvaI CCWGG 1 cut(s) 488
MwoI GCNNNNNNNGC 6 cut(s) 36, 215, 403, 635, 695, 864
NdeII GATC 2 cut(s) 280, 301
NheI GCTAGC 2 cut(s) 625, 638
NlaIII CATG 2 cut(s) 205, 524
NlaIV GGNNCC 1 cut(s) 426
NmeAIII GCCGAG 1 cut(s) 453
PaqCI CACCTGC 1 cut(s) 335
PceI AGGCCT 1 cut(s) 486
PctI GAATGC 2 cut(s) 241, 895
PflMI CCANNNNNTGG 1 cut(s) 521
PinAI ACCGGT 1 cut(s) 584
PkrI GCNGC 6 cut(s) 137, 187, 208, 405, 561, 835
PleI GAGTC 1 cut(s) 366
PpsI GAGTC 1 cut(s) 366
Psp6I CCWGG 1 cut(s) 486
PspFI CCCAGC 1 cut(s) 569
PspGI CCWGG 1 cut(s) 486
PspN4I GGNNCC 1 cut(s) 426
PspPI GGNCC 3 cut(s) 179, 425, 769
PsuI RGATCY 1 cut(s) 301
PvuII CAGCTG 2 cut(s) 403, 573
RsaI GTAC 2 cut(s) 530, 701
RsaNI GTAC 2 cut(s) 529, 700
SaqAI TTAA 1 cut(s) 147
SatI GCNGC 6 cut(s) 136, 186, 207, 404, 560, 834
Sau3AI GATC 2 cut(s) 280, 301
Sau96I GGNCC 3 cut(s) 179, 425, 769
SchI GAGTC 1 cut(s) 367
ScrFI CCNGG 1 cut(s) 488
SduI GDGCHC 1 cut(s) 277
SetI ASST 8 cut(s) 322, 349, 405, 520, 564, 575, 619, 644
SfaNI GCATC 3 cut(s) 227, 499, 845
SfcI CTRYAG 1 cut(s) 574
SinI GGWCC 1 cut(s) 769
Sse9I AATT 4 cut(s) 17, 44, 124, 876
SseBI AGGCCT 1 cut(s) 486
SsiI CCGC 3 cut(s) 135, 767, 833
SspMI CTAG 5 cut(s) 329, 362, 626, 639, 785
StuI AGGCCT 1 cut(s) 486
StyD4I CCNGG 1 cut(s) 486
StyI CCWWGG 2 cut(s) 213, 660
TaaI ACNGT 1 cut(s) 906
TaqI TCGA 1 cut(s) 279
TasI AATT 4 cut(s) 17, 44, 124, 876
TatI WGTACW 1 cut(s) 528
TauI GCSGC 2 cut(s) 138, 836
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 294
TseI GCWGC 4 cut(s) 185, 206, 403, 559
TspDTI ATGAA 2 cut(s) 467, 554
TspRI CASTG 1 cut(s) 294
Van91I CCANNNNNTGG 1 cut(s) 521
VpaK11BI GGWCC 1 cut(s) 769
XapI RAATTY 4 cut(s) 17, 44, 124, 876
XspI CTAG 5 cut(s) 329, 362, 626, 639, 785
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.