Rmu_sc0006945.1_g000031

Cyclic nucleotide-gated ion channel 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006945.1
Physical Location & Seq
Reverse (-)
116020 .. 116364
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006945.1_g000031.1.cds

Sequence Viewer

Length: 345 bp
ctggagaacggtgatgtttatggagaagaacaacttctgagttgggcatcaccagccgacatgtcctatatctcttatgcagaccttcctatcttgaccgaaaatgtaaaatgtctttcagaggtagaaggctttgttctcactgccaaggacttgaaaaatgaagtctccgtgtacaagttacatgggaattacaatagttccagccatctagtggaggagatggaacgtgctatctcaggaggaacatcaatggttcgtcgtaaccgcattaatcctaccccatggccaggcacagatcagggcgggaacgaggaaacagatattcaagattcaaataactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.64

Weight (kDa)

4.36

Isoelectric Point (pI)

42.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 214
AciI CCGC 2 cut(s) 268, 306
AcoI YGGCCR 1 cut(s) 287
AfaI GTAC 1 cut(s) 176
AfiI CCNNNNNNNGG 2 cut(s) 214, 290
AflIII ACRYGT 1 cut(s) 60
AgsI TTSAA 3 cut(s) 157, 329, 336
AjnI CCWGG 1 cut(s) 289
Alw26I GTCTC 1 cut(s) 172
AoxI GGCC 1 cut(s) 287
AseI ATTAAT 1 cut(s) 273
Asp700I GAANNNNTTC 1 cut(s) 33
AsuHPI GGTGA 2 cut(s) 23, 42
BalI TGGCCA 1 cut(s) 289
BccI CCATC 2 cut(s) 216, 217
BciT130I CCWGG 1 cut(s) 291
BcoDI GTCTC 1 cut(s) 172
BfaI CTAG 1 cut(s) 212
Bme1390I CCNGG 1 cut(s) 291
BmrFI CCNGG 1 cut(s) 291
BmsI GCATC 1 cut(s) 56
BpmI CTGGAG 1 cut(s) 23
BsaJI CCNNGG 2 cut(s) 147, 284
Bsc4I CCNNNNNNNGG 2 cut(s) 214, 290
BseBI CCWGG 1 cut(s) 291
BseDI CCNNGG 2 cut(s) 147, 284
BseLI CCNNNNNNNGG 2 cut(s) 214, 290
BseMII CTCAG 2 cut(s) 29, 252
BseRI GAGGAG 1 cut(s) 233
BshFI GGCC 1 cut(s) 289
BslI CCNNNNNNNGG 2 cut(s) 214, 290
BsmAI GTCTC 1 cut(s) 172
BsnI GGCC 1 cut(s) 289
Bsp1407I TGTACA 1 cut(s) 174
Bsp143I GATC 1 cut(s) 298
Bsp19I CCATGG 1 cut(s) 284
BspACI CCGC 2 cut(s) 268, 306
BspANI GGCC 1 cut(s) 289
BspCNI CTCAG 2 cut(s) 30, 251
BsrGI TGTACA 1 cut(s) 174
BssECI CCNNGG 2 cut(s) 147, 284
BssMI GATC 1 cut(s) 298
BssT1I CCWWGG 2 cut(s) 147, 284
Bst2UI CCWGG 1 cut(s) 291
Bst4CI ACNGT 1 cut(s) 11
BstAUI TGTACA 1 cut(s) 174
BstDEI CTNAG 2 cut(s) 38, 238
BstDSI CCRYGG 1 cut(s) 284
BstKTI GATC 1 cut(s) 301
BstMAI GTCTC 1 cut(s) 172
BstMBI GATC 1 cut(s) 298
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstNI CCWGG 1 cut(s) 291
BstNSI RCATGY 1 cut(s) 64
BstSCI CCNGG 1 cut(s) 289
BsuRI GGCC 1 cut(s) 289
BtgI CCRYGG 1 cut(s) 284
BtsI GCAGTG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 141
Csp6I GTAC 1 cut(s) 175
CviAII CATG 3 cut(s) 61, 185, 285
CviJI RGCY 4 cut(s) 56, 132, 207, 289
CviKI_1 RGCY 4 cut(s) 56, 132, 207, 289
CviQI GTAC 1 cut(s) 175
DdeI CTNAG 2 cut(s) 38, 238
DpnI GATC 1 cut(s) 300
DpnII GATC 1 cut(s) 298
EaeI YGGCCR 1 cut(s) 287
Eco130I CCWWGG 2 cut(s) 147, 284
EcoRII CCWGG 1 cut(s) 289
EcoT14I CCWWGG 2 cut(s) 147, 284
ErhI CCWWGG 2 cut(s) 147, 284
FaeI CATG 3 cut(s) 64, 188, 288
FaiI YATR 6 cut(s) 21, 62, 69, 78, 186, 286
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FatI CATG 3 cut(s) 60, 184, 284
FauI CCCGC 1 cut(s) 299
FspBI CTAG 1 cut(s) 212
GsuI CTGGAG 1 cut(s) 23
HaeIII GGCC 1 cut(s) 289
Hin1II CATG 3 cut(s) 64, 188, 288
HinfI GANTC 1 cut(s) 332
HphI GGTGA 2 cut(s) 23, 42
Hpy166II GTNNAC 1 cut(s) 175
Hpy188I TCNGA 2 cut(s) 39, 121
Hpy188III TCNNGA 3 cut(s) 94, 240, 329
Hpy8I GTNNAC 1 cut(s) 175
Hpy99I CGWCG 1 cut(s) 264
HpyAV CCTTC 2 cut(s) 95, 122
HpyCH4III ACNGT 1 cut(s) 11
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 2 cut(s) 38, 238
HpySE526I ACGT 1 cut(s) 229
Hsp92II CATG 3 cut(s) 64, 188, 288
Kzo9I GATC 1 cut(s) 298
LpnPI CCDG 6 cut(s) 66, 217, 225, 276, 287, 303
LweI GCATC 1 cut(s) 56
MaeI CTAG 1 cut(s) 212
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 2 cut(s) 180, 263
MalI GATC 1 cut(s) 300
MboI GATC 1 cut(s) 298
MboII GAAGA 1 cut(s) 38
MlsI TGGCCA 1 cut(s) 289
MluCI AATT 1 cut(s) 190
MluNI TGGCCA 1 cut(s) 289
MnlI CCTC 4 cut(s) 115, 211, 236, 307
Mox20I TGGCCA 1 cut(s) 289
MroXI GAANNNNTTC 1 cut(s) 33
MscI TGGCCA 1 cut(s) 289
MseI TTAA 1 cut(s) 273
Msp20I TGGCCA 1 cut(s) 289
MspR9I CCNGG 1 cut(s) 291
MvaI CCWGG 1 cut(s) 291
MwoI GCNNNNNNNGC 1 cut(s) 53
NcoI CCATGG 1 cut(s) 284
NdeII GATC 1 cut(s) 298
NlaIII CATG 3 cut(s) 64, 188, 288
NspI RCATGY 1 cut(s) 64
PciI ACATGT 1 cut(s) 60
PdmI GAANNNNTTC 1 cut(s) 33
PfeI GAWTC 1 cut(s) 332
PflMI CCANNNNNTGG 1 cut(s) 214
PscI ACATGT 1 cut(s) 60
PshBI ATTAAT 1 cut(s) 273
Psp6I CCWGG 1 cut(s) 289
PspGI CCWGG 1 cut(s) 289
RsaI GTAC 1 cut(s) 176
RsaNI GTAC 1 cut(s) 175
SaqAI TTAA 1 cut(s) 273
Sau3AI GATC 1 cut(s) 298
ScrFI CCNGG 1 cut(s) 291
SetI ASST 3 cut(s) 87, 126, 232
SfaNI GCATC 1 cut(s) 56
Sse9I AATT 1 cut(s) 190
SsiI CCGC 2 cut(s) 268, 306
SspMI CTAG 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 289
StyI CCWWGG 2 cut(s) 147, 284
TaaI ACNGT 1 cut(s) 11
TaiI ACGT 1 cut(s) 232
TaqII GACCGA 1 cut(s) 113
TasI AATT 1 cut(s) 190
TatI WGTACW 1 cut(s) 174
TfiI GAWTC 1 cut(s) 332
Tru1I TTAA 1 cut(s) 273
Tru9I TTAA 1 cut(s) 273
TscAI CASTG 1 cut(s) 148
TspDTI ATGAA 1 cut(s) 177
TspGWI ACGGA 1 cut(s) 160
TspRI CASTG 1 cut(s) 148
Van91I CCANNNNNTGG 1 cut(s) 214
VspI ATTAAT 1 cut(s) 273
XceI RCATGY 1 cut(s) 64
XcmI CCANNNNNNNNNTGG 1 cut(s) 211
XmnI GAANNNNTTC 1 cut(s) 33
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.