Rmu_sc0007474.1_g000006
MYB Family

HSA

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007474.1
Physical Location & Seq
Forward (+)
18325 .. 31310
12986 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007474.1_g000006.1.cds

Sequence Viewer

Length: 6306 bp
atgagagtaagttttggtgatgctagagtagattttcttactggtgagtgtagctttctggtgttggtgacggtagcgtttattgctggtgagcgtagctattgcgcccaaaaaaaccctaggagagagaaatttacgcgcaattcaactcccccactgctgcccctgctctgccctagctcccaatttcgctaccctattcctaatttcagagattttatagaatttggattagatgggagattaaaggttgtgggcattaaagtcggaatgcatggatgtggctcaggatctgctctcctagtaaatgcagaggtggattccatgggtggagtggttgacggcggagttggtgttggtttgaaaacatctccgcgcagagcagcaattgagaaggctcaagcagagcttagacaggaatatgatgtgcgggaggaaaggagaagggagctagaatttcttgagaaaggtggcaatcctttggacttcaaatttgggaatgcagcttctgttagtgtccagtccacttccctcactgatcagcatccagaacagtttgtgaccagtgaagcaaaaggtagttttgcattgactgcatcacctcgtggggactctgttgaaagtagtggtcgaccagaggttcctacactttgtgaacccaacagtgctgataatctcttactttttgatggggacaatgatacaccggaaggggaaaggaaatctatgcatattagtagaagaaataaaattgctccatcagaacagtcttcccagatggatgggactcaaaatgccaaggaatcagaagactcagcgattttccgtccctatgctcgaaggaacaggtccagaccaaatcgtgatggtactcgttcaagttcaactgatgtacagggccgtggtggtcaagggtcttcattaccttctcgcggggcgttaaagaatcccaagggaccggtatttgaaacaaacaaccaaaaggaccagaatataccttcggtcactaatctaaagtctgtgaagtctaatggtgattttgcttctagggttgcaacttctgataatcagttggatatggactttgatggggtgcaggctcctgaaatatttactggtccagcaaaagatagtcctgaaaaaaaattggatgttacagctactgaaagtttgaaagagagccaacatagtcaaccatctcagactgatactcaggaaattccaattgctgcagtttcggggagatctgatgagagggagccgttagcttcgtctgttcttgaatgtcttcgttgtgaagctactacaaagaccgaaattgatattagttctgtccaggtgaatggatttagtaatttaaatagagagagtaaaagtgtaccaaatgaaggtcaaattagcagtgcagcgggcacaaaggggttagattcagaatcttcttgtacccaaactagtgtaggattagatgtaaataatgatactgacgtatgtactacaaggaatgctgataatgcaaatatcatggaaacatcagatgttgatggggcacaaaatccagctggtgatgaaatgttactagaaaagaatgaaagcagagctgttgacagtagtcctatgattaatgatcctcatgcttctgattttcagaacaatcgctcaggcaatactgaagtgaaagttgaggaagatatgaacgaaagtagatctgaagtgcgtaatgaagtaaagcttcatccaaacactgagggagagcaacaaagtggttgtactatatcagaagctgaaaagaaactggatgatgtggtggataatggttccaacatcaagaaagagaactcttctggcagaccccagactcctcaggatttatctatgtgtcagcttcctgaaactattttgccagcgatagactctgccaagggttcagactgtcagacttctgatagtcactttaaagtggtagacaaggcacatgaagattctattttggaagaggctcggatgatagaggccaagcgtaagaggattgcagaattatccgttcgttctttaccctccgagaatcaccgaaagtctcagtgggattttgtccttgaggaaatgtcgtggttggccaatgattttgctcaggagcgcctttggaagctaactgctgctgctcaaatatgccatcgtgttgcttttacatcacggttgagaattgacgagcaacaacaacaatgggggattaaaaaagtggctcgtaccctggcaaatgctgtcaaccaattttggcattcagctgggacccttttgtatgctgatgattcaagtgattgtcacaacatcaccaagagcaatttgaattcgagcaaagagccttgcaaagagttggagctacaatggagcaacaacttttcactttctatgcagcggtatgcagtgagatttttgaagtataacaactctcttggtcctcaacttcaagcacaagctcctgctactcctgagagattgtctgatttaggcattacagaaatgtcatgggaggaccatcttacagaagaaaacctcttttatgcagttccatctggggcactggaaacctacagaagatcaattgaatctcatttggttcagtgtgagagaactagcagtagcatgcaagaagaggttgatacatccatgtatgaggctggagctgagtttgatagtcgagagacttctgcatacgatgaggatgaaggagaaacaacatgcacctattatttgcctggggccttcgaaggtagcaagtcatcaacatttaatcagaagaagcggaagtattataagtcatataatcctaggacccatgaagcaggagctgattttccctatggacaaacagcaaatcaacagttcatgttgatggggaaaaggcctgctagtcttaatgttggttcaatcccaacaaaacgcgtgcgcactgcttcgaggcagagggttgttagtccatttggtgctggagctactgggaatgttcaggctcaaattaagacagatgcttctagtggagatactaattcttttcaggatgatcagagtaccttacccggcggatcccagttccctagaagtatggaggtggagtctgttcgtgattttgaaaagcatccacaatgtgaccatgcagaaacatcaaagcataaaaagaagaagaaggcaaaacatctgggttctgcttatgaccaagtatggcaggtggattcacctactcataatgagcagagggatcattcaaaaaagagattagaaagtcatcattttgagtccaatggaacatttggtttatatgggcaacataatgcaaagaggctgaagatatcaaaacagtctctagacaatacttatgatggtataactccaatgactgggtccattccttctccagtggcgtcccaaatgagtaatatgaccaatccgagtaaattgatgaagttgatcggtggtcgggacaagggacggaaagctaaatcaatgaagatgcctgttggccagccaggttctggaagtccatggtcactattcgaagatcaggcacttgttgttcttgtacatgatatgggtccaaattgggaactcataagtgatgctatcaacagtactctgcacctaaagtgtatcttccgcaagcctaaggaatgcaaggagcgtcacaaaattttaatggatttgaatactggtgatggggctgacagtgctgaagattcagggtcatcacagccttatccatctacaatccctggcattccaaagggaagtgccagacagttatttcaacgcttgcaagagccaatggaagaggacactctcaagtctcattttgaaagaataattaagattgggcagaagcatcattataggaggagtcagagtgataaccaggatccaaaacaaggaacgacagtccacaattctcatgttatcgctctttcccaagtatgtccgaataacctgaatggtgttattctaacgcctcttgatctctgtgatgccacatcatcaagcccagatgttcttccgactgcatatcaaggttctcacactagtggcttaccaatggcaaatcagggcgctatggcgtcattactgccctctgggccaaatgcctcattacagggaacttctggtatggttcttggtagcaacttgtcatcaccatctggcccgcttagtgcgacagtcagggatggtaggtacggtggtccaagggcatctactttaccagttgaagagcagcaaagaatgcaacactacaatcaaatgttatctggtagaaacattcagcagtccagcttgtccgtacctggggctcttccaggaggtactgatcgtggtgttcgaatggtacctggtgcaaatggtatgggcatgatgtgtgggatgaatagaagcacaatgtcaaggccagggtttcagggaatggcttcttcctcgatgctgaatactgggagtatgctttcatccagtatggttggaataccaagtcctgtaaatatgcactctggagctggttccggtccaggaaatttgatgttaagacctcgcgagggtcacatgatgcggcctgcccataatccggatcaccaaaggcaacttatggctccagagcttcagatgcaggtcacgcaagggaatggccaaggtattgctccattcaatgggttgagttctggctttcctagtcagacaactccatcaggtgcacaaatgtatccaggccatccccagcagcaacatcagttatccccacaacaatctcatgcagtcggcagccctcatcaccctcatcttcaaggccccaatcatgtgacagggtcgccgcagcaagcctatgccatgcgcatggctaaagtgcatcaacagcggtttttgcagcagcagcagcagcagtttgcatcatccaattctttggtgccgcatgtccaaccacaggcccaactccccatttcttcaactttgcaaaatagttcccagattcagtcacaaagttcacctcacccagcatctatgtcccctagtacaccttcttccccaatgactccggtatcatcccaacaccagcagaaacatcacctgccacctcatgggatgagtcggaatcctggtgcaagcgggttgactaatcaaatagggaagcaacgacaaaggccacaacaacaccatcttcagcaatctgggaggcaccaccctcagcagcggccatttgggcaatctcagcagcaggctaaactttcgaagggaatgggaagagggaatccaatggtgcatcaaaaccttgccatcgatcctataaacatctccattgatccatctcatctgaatgggctttcgatgcctccgggaagtcaagctctggataaaggagaacagatcatgcagttaatgcaaggtcaagctgcatattcggggtctggcgtcaacccagtaacatcaaaaccattggttcctcaatcatcaaacaactctccgatgcagcaaaagttgcattctagctcagctacctcttcgacgaagcaactccagcaaaagccatctcattctgataacagcactcaaggccaggcaccagctgttccttctggtcatgcaatatcagcttcacatcaatctgtgtctccagcaattgtgtcttccaatcaccagcaggtgcagccacagcaacagcaacagcaacagaagcaagctaatcagactcagccatatgttcagagagtccagcagaatcgtcaagtgaattcggagctgccaagcaagcctccaaatgatttagcttcagccgaagagcagcctgtgaatagtacttctctgattggttcaagcatggcaattcctcagtcctctattgattcgtctaatgtagtaccggtttcttctggcattactcaatggaaatcatcagaagcagtatatgattctaatctgccaaattcaacagctcaagagggttcacttgggagcccatcaccaacaaattcatctgggaatgagccagtgcccccttttagtcaaggtttaggcccaaggcagttatctggtaactttgcctctcatggacatattgctggtgcgcaatggcagcagaagcagctactgcaaaagcctccttcgctaccacccctgtcccaacaactctacgagcaacaagagcaacagcagcagcaggaacaagaatcaccccaacatcaactgcctttgccacagcagtctcagcaacaaatgcagcatctgccagcagggcaaggtggtttgtatatgatgcctagtaattcaaaatcagaatga

Protein Analysis

2101

Amino Acids

228.97

Weight (kDa)

6.59

Isoelectric Point (pI)

60.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2811
AarI CACCTGC 3 cut(s) 3211, 5106, 5659
Acc16I TGCGCA 3 cut(s) 2945, 4865, 6093
Acc36I ACCTGC 4 cut(s) 3211, 4633, 5106, 5659
Acc65I GGTACC 1 cut(s) 4369
AccB1I GGYRCC 4 cut(s) 4369, 4936, 5205, 5587
AccB7I CCANNNNNTGG 4 cut(s) 3392, 3527, 4682, 5108
AccI GTMKAC 2 cut(s) 631, 1962
AccII CGCG 5 cut(s) 139, 376, 933, 2940, 4569
AccIII TCCGGA 1 cut(s) 4600
AcoI YGGCCR 4 cut(s) 2112, 3514, 4660, 5222
AcuI CTGAAG 7 cut(s) 1689, 1728, 3359, 3744, 4619, 5174, 5781
AcyI GRCGYC 3 cut(s) 3416, 4103, 5439
AdeI CACNNNGTG 3 cut(s) 605, 653, 3143
AflIII ACRYGT 1 cut(s) 2938
AgeI ACCGGT 2 cut(s) 958, 5887
AhlI ACTAGT 2 cut(s) 1451, 4067
AleI CACNNNNGTG 1 cut(s) 4068
Alw21I GWGCWC 1 cut(s) 4729
Alw26I GTCTC 6 cut(s) 2079, 2693, 3360, 3843, 5643, 6234
Alw44I GTGCAC 1 cut(s) 4725
AlwNI CAGNNNCTG 8 cut(s) 293, 509, 1163, 1781, 2846, 3527, 6115, 6250
Aor13HI TCCGGA 1 cut(s) 4600
ApaLI GTGCAC 1 cut(s) 4725
ArsI GACNNNNNNTTYG 2 cut(s) 476, 508
AseI ATTAAT 1 cut(s) 1620
AsiGI ACCGGT 2 cut(s) 958, 5887
Asp700I GAANNNNTTC 2 cut(s) 1287, 4447
Asp718I GGTACC 1 cut(s) 4369
AspA2I CCTAGG 2 cut(s) 119, 2825
AspLEI GCGC 8 cut(s) 107, 141, 378, 2136, 2946, 4097, 4866, 6094
AsuC2I CCSGG 2 cut(s) 3075, 5364
AsuII TTCGAA 4 cut(s) 2763, 3549, 4363, 5258
AvrII CCTAGG 2 cut(s) 119, 2825
AxyI CCTNAGG 2 cut(s) 1860, 3657
BaeGI GKGCMC 5 cut(s) 1415, 1549, 2578, 4729, 6021
BaeI ACNNNNGTAYC 8 cut(s) 1470, 1503, 4210, 4243, 4718, 4751, 5052, 5085
BalI TGGCCA 3 cut(s) 2114, 3516, 4662
BamHI GGATCC 2 cut(s) 3080, 3907
BanI GGYRCC 4 cut(s) 4369, 4936, 5205, 5587
BanII GRGCYC 2 cut(s) 4336, 5984
BarI GAAGNNNNNNTAC 2 cut(s) 5035, 5067
BauI CACGAG 1 cut(s) 603
BbsI GAAGAC 5 cut(s) 762, 816, 909, 1280, 5646
Bbv12I GWGCWC 1 cut(s) 4729
BbvCI CCTCAGC 1 cut(s) 5214
BceAI ACGGC 3 cut(s) 358, 885, 1246
BcgI CGANNNNNNTGC 2 cut(s) 247, 281
BciVI GTATCC 1 cut(s) 4746
BclI TGATCA 2 cut(s) 538, 3058
BcnI CCSGG 2 cut(s) 3075, 5364
BcoDI GTCTC 6 cut(s) 2079, 2693, 3360, 3843, 5643, 6234
BcuI ACTAGT 2 cut(s) 1451, 4067
BfmI CTRYAG 2 cut(s) 1230, 2587
BfoI RGCGCY 2 cut(s) 2137, 4098
BfuAI ACCTGC 4 cut(s) 3211, 4633, 5106, 5659
BfuI GTATCC 1 cut(s) 4746
BglI GCCNNNNNGGC 3 cut(s) 4120, 5230, 6259
BglII AGATCT 2 cut(s) 1244, 1703
BlnI CCTAGG 2 cut(s) 119, 2825
BlpI GCTNAGC 1 cut(s) 5518
BmcAI AGTACT 2 cut(s) 3625, 5824
BmrI ACTGGG 5 cut(s) 3003, 3079, 3402, 4479, 5441
BmuI ACTGGG 5 cut(s) 3003, 3079, 3402, 4479, 5441
BoxI GACNNNNGTC 1 cut(s) 1608
BpiI GAAGAC 5 cut(s) 762, 816, 909, 1280, 5646
BpmI CTGGAG 7 cut(s) 2697, 3006, 3393, 4548, 4611, 5528, 5625
Bpu10I CCTNAGC 4 cut(s) 286, 1657, 2127, 5214
Bpu1102I GCTNAGC 1 cut(s) 5518
Bpu14I TTCGAA 4 cut(s) 2763, 3549, 4363, 5258
BpuEI CTTGAG 6 cut(s) 384, 482, 2114, 3818, 5562, 5946
BpuMI CCSGG 2 cut(s) 3075, 5364
Bsa29I ATCGAT 1 cut(s) 5307
BsaBI GATNNNNATC 2 cut(s) 543, 5940
BsaHI GRCGYC 3 cut(s) 3416, 4103, 5439
BsaWI WCCGGW 6 cut(s) 706, 958, 4538, 4600, 5065, 5887
BsaXI ACNNNNNCTCC 6 cut(s) 339, 369, 3095, 3125, 3880, 3910
Bse118I RCCGGY 2 cut(s) 958, 5887
Bse21I CCTNAGG 2 cut(s) 1860, 3657
Bse3DI GCAATG 1 cut(s) 6101
Bse8I GATNNNNATC 2 cut(s) 543, 5940
BseAI TCCGGA 1 cut(s) 4600
BseCI ATCGAT 1 cut(s) 5307
BseJI GATNNNNATC 2 cut(s) 543, 5940
BseMI GCAATG 1 cut(s) 6101
BseRI GAGGAG 2 cut(s) 1848, 3901
BseSI GKGCMC 5 cut(s) 1415, 1549, 2578, 4729, 6021
BseYI CCCAGC 3 cut(s) 2282, 4749, 5023
BsgI GTGCAG 4 cut(s) 1115, 1425, 3614, 5693
Bsh1236I CGCG 5 cut(s) 139, 376, 933, 2940, 4569
BshNI GGYRCC 4 cut(s) 4369, 4936, 5205, 5587
BshTI ACCGGT 2 cut(s) 958, 5887
BshVI ATCGAT 1 cut(s) 5307
BsiHKAI GWGCWC 1 cut(s) 4729
BsiSI CCGG 8 cut(s) 707, 959, 3075, 4539, 4601, 5066, 5363, 5888
BsmAI GTCTC 6 cut(s) 2079, 2693, 3360, 3843, 5643, 6234
BsmI GAATGC 8 cut(s) 276, 505, 1507, 2275, 3668, 3768, 4272, 5509
Bsp119I TTCGAA 4 cut(s) 2763, 3549, 4363, 5258
Bsp1286I GDGCHC 7 cut(s) 1415, 1549, 2578, 4336, 4729, 5984, 6021
Bsp13I TCCGGA 1 cut(s) 4600
Bsp1407I TGTACA 2 cut(s) 892, 3574
Bsp1720I GCTNAGC 1 cut(s) 5518
Bsp19I CCATGG 2 cut(s) 324, 3536
Bsp68I TCGCGA 1 cut(s) 4569
BspDI ATCGAT 1 cut(s) 5307
BspEI TCCGGA 1 cut(s) 4600
BspFNI CGCG 5 cut(s) 139, 376, 933, 2940, 4569
BspMAI CTGCAG 1 cut(s) 1234
BspMI ACCTGC 4 cut(s) 3211, 4633, 5106, 5659
BspQI GCTCTTC 3 cut(s) 4248, 4341, 5799
BspT104I TTCGAA 4 cut(s) 2763, 3549, 4363, 5258
BspT107I GGYRCC 4 cut(s) 4369, 4936, 5205, 5587
BsrDI GCAATG 1 cut(s) 6101
BsrFI RCCGGY 2 cut(s) 958, 5887
BsrGI TGTACA 2 cut(s) 892, 3574
BssAI RCCGGY 2 cut(s) 958, 5887
BssNI GRCGYC 3 cut(s) 3416, 4103, 5439
BssSI CACGAG 1 cut(s) 603
Bst2BI CACGAG 1 cut(s) 603
Bst6I CTCTTC 9 cut(s) 1843, 1986, 2643, 3816, 4248, 4341, 5266, 5533, 5799
BstACI GRCGYC 3 cut(s) 3416, 4103, 5439
BstAPI GCANNNNNTGC 7 cut(s) 593, 4267, 5407, 5506, 6115, 6241, 6250
BstAUI TGTACA 2 cut(s) 892, 3574
BstBI TTCGAA 4 cut(s) 2763, 3549, 4363, 5258
BstDSI CCRYGG 3 cut(s) 324, 901, 3536
BstFNI CGCG 5 cut(s) 139, 376, 933, 2940, 4569
BstH2I RGCGCY 2 cut(s) 2137, 4098
BstHHI GCGC 8 cut(s) 107, 141, 378, 2136, 2946, 4097, 4866, 6094
BstMAI GTCTC 6 cut(s) 2079, 2693, 3360, 3843, 5643, 6234
BstNSI RCATGY 3 cut(s) 2644, 2739, 4946
BstPAI GACNNNNGTC 1 cut(s) 1608
BstSFI CTRYAG 2 cut(s) 1230, 2587
BstSLI GKGCMC 5 cut(s) 1415, 1549, 2578, 4729, 6021
BstUI CGCG 5 cut(s) 139, 376, 933, 2940, 4569
BstV2I GAAGAC 5 cut(s) 762, 816, 909, 1280, 5646
BstX2I RGATCY 5 cut(s) 290, 1244, 1703, 3080, 3907
BstXI CCANNNNNNTGG 4 cut(s) 782, 1343, 4867, 4933
BstYI RGATCY 5 cut(s) 290, 1244, 1703, 3080, 3907
Bsu15I ATCGAT 1 cut(s) 5307
Bsu36I CCTNAGG 2 cut(s) 1860, 3657
BsuI GTATCC 1 cut(s) 4746
BsuTUI ATCGAT 1 cut(s) 5307
BtgI CCRYGG 3 cut(s) 324, 901, 3536
BtsI GCAGTG 4 cut(s) 155, 1408, 2427, 2946
BtuMI TCGCGA 1 cut(s) 4569
BveI ACCTGC 4 cut(s) 3211, 4633, 5106, 5659
CaiI CAGNNNCTG 8 cut(s) 293, 509, 1163, 1781, 2846, 3527, 6115, 6250
CfoI GCGC 8 cut(s) 107, 141, 378, 2136, 2946, 4097, 4866, 6094
Cfr10I RCCGGY 2 cut(s) 958, 5887
ClaI ATCGAT 1 cut(s) 5307
CseI GACGC 4 cut(s) 3405, 3662, 4092, 5428
CsiI ACCWGGT 1 cut(s) 4372
CspAI ACCGGT 2 cut(s) 958, 5887
DraI TTTAAA 2 cut(s) 1359, 1954
DraIII CACNNNGTG 3 cut(s) 605, 653, 3143
EaeI YGGCCR 4 cut(s) 2112, 3514, 4660, 5222
Eam1104I CTCTTC 9 cut(s) 1843, 1986, 2643, 3816, 4248, 4341, 5266, 5533, 5799
EarI CTCTTC 9 cut(s) 1843, 1986, 2643, 3816, 4248, 4341, 5266, 5533, 5799
EciI GGCGGA 2 cut(s) 360, 3093
Eco147I AGGCCT 1 cut(s) 2902
Eco24I GRGCYC 2 cut(s) 4336, 5984
Eco32I GATATC 1 cut(s) 3345
Eco57I CTGAAG 7 cut(s) 1689, 1728, 3359, 3744, 4619, 5174, 5781
Eco81I CCTNAGG 2 cut(s) 1860, 3657
EcoO109I RGGNCCY 4 cut(s) 2286, 2757, 2829, 4820
EcoRI GAATTC 2 cut(s) 2344, 5758
EcoRV GATATC 1 cut(s) 3345
EcoT22I ATGCAT 2 cut(s) 276, 732
EcoT38I GRGCYC 2 cut(s) 4336, 5984
FalI AAGNNNNNCTT 6 cut(s) 393, 425, 1713, 1745, 3629, 3661
FauI CCCGC 5 cut(s) 423, 926, 1402, 4197, 5129
FauNDI CATATG 1 cut(s) 5725
FbaI TGATCA 2 cut(s) 538, 3058
FblI GTMKAC 2 cut(s) 631, 1962
FriOI GRGCYC 2 cut(s) 4336, 5984
FspAI RTGCGCAY 2 cut(s) 2945, 4865
FspI TGCGCA 3 cut(s) 2945, 4865, 6093
GlaI GCGC 8 cut(s) 106, 140, 377, 2135, 2945, 4096, 4865, 6093
GsaI CCCAGC 3 cut(s) 2286, 4753, 5027
GsuI CTGGAG 7 cut(s) 2697, 3006, 3393, 4548, 4611, 5528, 5625
HaeII RGCGCY 2 cut(s) 2137, 4098
HapII CCGG 8 cut(s) 707, 959, 3075, 4539, 4601, 5066, 5363, 5888
HgaI GACGC 4 cut(s) 3405, 3662, 4092, 5428
HhaI GCGC 8 cut(s) 107, 141, 378, 2136, 2946, 4097, 4866, 6094
Hin1I GRCGYC 3 cut(s) 3416, 4103, 5439
Hin6I GCGC 8 cut(s) 105, 139, 376, 2134, 2944, 4095, 4864, 6092
HinP1I GCGC 8 cut(s) 105, 139, 376, 2134, 2944, 4095, 4864, 6092
HincII GTYRAC 7 cut(s) 340, 632, 1193, 1603, 2263, 5142, 5443
HindII GTYRAC 7 cut(s) 340, 632, 1193, 1603, 2263, 5142, 5443
HindIII AAGCTT 1 cut(s) 1727
HpaII CCGG 8 cut(s) 707, 959, 3075, 4539, 4601, 5066, 5363, 5888
Hpy99I CGWCG 1 cut(s) 5536
HpyCH4IV ACGT 1 cut(s) 1485
HpySE526I ACGT 1 cut(s) 1485
Hsp92I GRCGYC 3 cut(s) 3416, 4103, 5439
HspAI GCGC 8 cut(s) 105, 139, 376, 2134, 2944, 4095, 4864, 6092
KflI GGGWCCC 1 cut(s) 2286
Kpn2I TCCGGA 1 cut(s) 4600
KpnI GGTACC 1 cut(s) 4373
Ksp22I TGATCA 2 cut(s) 538, 3058
LguI GCTCTTC 3 cut(s) 4248, 4341, 5799
MabI ACCWGGT 1 cut(s) 4372
MaeII ACGT 1 cut(s) 1485
MfeI CAATTG 4 cut(s) 387, 1224, 2598, 5646
MflI RGATCY 5 cut(s) 290, 1244, 1703, 3080, 3907
MhlI GDGCHC 7 cut(s) 1415, 1549, 2578, 4336, 4729, 5984, 6021
MlsI TGGCCA 3 cut(s) 2114, 3516, 4662
MluI ACGCGT 1 cut(s) 2938
MluNI TGGCCA 3 cut(s) 2114, 3516, 4662
MmeI TCCRAC 8 cut(s) 247, 1053, 1842, 2352, 4067, 4477, 4972, 5099
Mox20I TGGCCA 3 cut(s) 2114, 3516, 4662
Mph1103I ATGCAT 2 cut(s) 276, 732
MroI TCCGGA 1 cut(s) 4600
MroXI GAANNNNTTC 2 cut(s) 1287, 4447
MscI TGGCCA 3 cut(s) 2114, 3516, 4662
MslI CAYNNNNRTG 5 cut(s) 279, 2888, 4068, 4865, 5343
Msp20I TGGCCA 3 cut(s) 2114, 3516, 4662
MspA1I CMGCKG 7 cut(s) 1409, 1559, 2282, 2413, 4888, 5221, 5594
MspI CCGG 8 cut(s) 707, 959, 3075, 4539, 4601, 5066, 5363, 5888
MunI CAATTG 4 cut(s) 387, 1224, 2598, 5646
Mva1269I GAATGC 8 cut(s) 276, 505, 1507, 2275, 3668, 3768, 4272, 5509
MvnI CGCG 5 cut(s) 139, 376, 933, 2940, 4569
NciI CCSGG 2 cut(s) 3075, 5364
NcoI CCATGG 2 cut(s) 324, 3536
NdeI CATATG 1 cut(s) 5725
NruI TCGCGA 1 cut(s) 4569
NsbI TGCGCA 3 cut(s) 2945, 4865, 6093
NsiI ATGCAT 2 cut(s) 276, 732
NspI RCATGY 3 cut(s) 2644, 2739, 4946
NspV TTCGAA 4 cut(s) 2763, 3549, 4363, 5258
OliI CACNNNNGTG 1 cut(s) 4068
PaeI GCATGC 1 cut(s) 2644
PaqCI CACCTGC 3 cut(s) 3211, 5106, 5659
PceI AGGCCT 1 cut(s) 2902
PciSI GCTCTTC 3 cut(s) 4248, 4341, 5799
PcsI WCGNNNNNNNCGW 1 cut(s) 4360
PctI GAATGC 8 cut(s) 276, 505, 1507, 2275, 3668, 3768, 4272, 5509
PdmI GAANNNNTTC 2 cut(s) 1287, 4447
PflFI GACNNNGTC 2 cut(s) 3394, 4837
PflMI CCANNNNNTGG 4 cut(s) 3392, 3527, 4682, 5108
PfoI TCCNGGA 3 cut(s) 4339, 4543, 5362
PinAI ACCGGT 2 cut(s) 958, 5887
PpuMI RGGWCCY 2 cut(s) 2286, 2829
PshAI GACNNNNGTC 1 cut(s) 1608
PshBI ATTAAT 1 cut(s) 1620
PsiI TTATAA 1 cut(s) 2811
Psp5II RGGWCCY 2 cut(s) 2286, 2829
PspFI CCCAGC 3 cut(s) 2282, 4749, 5023
PspPPI RGGWCCY 2 cut(s) 2286, 2829
PstI CTGCAG 1 cut(s) 1234
PstNI CAGNNNCTG 8 cut(s) 293, 509, 1163, 1781, 2846, 3527, 6115, 6250
PsuI RGATCY 5 cut(s) 290, 1244, 1703, 3080, 3907
PsyI GACNNNGTC 2 cut(s) 3394, 4837
PvuII CAGCTG 3 cut(s) 1559, 2282, 5594
RruI TCGCGA 1 cut(s) 4569
RseI CAYNNNNRTG 5 cut(s) 279, 2888, 4068, 4865, 5343
SalI GTCGAC 1 cut(s) 630
SapI GCTCTTC 3 cut(s) 4248, 4341, 5799
ScaI AGTACT 2 cut(s) 3625, 5824
SduI GDGCHC 7 cut(s) 1415, 1549, 2578, 4336, 4729, 5984, 6021
SexAI ACCWGGT 1 cut(s) 4372
SfcI CTRYAG 2 cut(s) 1230, 2587
SfuI TTCGAA 4 cut(s) 2763, 3549, 4363, 5258
SmiI ATTTAAAT 1 cut(s) 1359
SmiMI CAYNNNNRTG 5 cut(s) 279, 2888, 4068, 4865, 5343
SmlI CTYRAG 6 cut(s) 399, 461, 2093, 3833, 5577, 5961
SmoI CTYRAG 6 cut(s) 399, 461, 2093, 3833, 5577, 5961
SpeI ACTAGT 2 cut(s) 1451, 4067
SphI GCATGC 1 cut(s) 2644
SseBI AGGCCT 1 cut(s) 2902
SspI AATATT 1 cut(s) 1110
StuI AGGCCT 1 cut(s) 2902
SwaI ATTTAAAT 1 cut(s) 1359
TaiI ACGT 1 cut(s) 1488
TaqII GACCGA 2 cut(s) 991, 1328
TatI WGTACW 7 cut(s) 892, 1490, 1766, 3574, 3623, 5042, 5822
TauI GCSGC 4 cut(s) 4588, 4846, 4942, 5224
TspGWI ACGGA 4 cut(s) 815, 2029, 3499, 4312
Tth111I GACNNNGTC 2 cut(s) 3394, 4837
Van91I CCANNNNNTGG 4 cut(s) 3392, 3527, 4682, 5108
VneI GTGCAC 1 cut(s) 4725
VspI ATTAAT 1 cut(s) 1620
XbaI TCTAGA 1 cut(s) 3358
XceI RCATGY 3 cut(s) 2644, 2739, 4946
XcmI CCANNNNNNNNNTGG 2 cut(s) 331, 3524
XmaJI CCTAGG 2 cut(s) 119, 2825
XmiI GTMKAC 2 cut(s) 631, 1962
XmnI GAANNNNTTC 2 cut(s) 1287, 4447
ZrmI AGTACT 2 cut(s) 3625, 5824
Zsp2I ATGCAT 2 cut(s) 276, 732
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.