Rmu_sc0007811.1_g000010

PAR1 protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007811.1
Physical Location & Seq
Reverse (-)
57233 .. 58349
1117 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007811.1_g000010.1.cds

Sequence Viewer

Length: 387 bp
atggataaacagtgcaggacatctgaagttgtggtagataagatggctgaatacatagagacagatgaatgtgtgaaggcatgtggtgttgatagggatgctgttggagtgttcttgccttacctatgtgtgagacaacgttcggaacctcaccgtaccaagagttctagcgctgtctctggccctgcttcagaacaagtagaagcaggagacagtgctatggccccctggtcctggatcagaggaccaatcaccaaacttgtacaaaagcgtttgcctatgcatctgtatactaaacacgctctccggttttcttcaaatcatttcctttcaaatattagtgacaggaatgaattttgtgggaaaaaaacaagggaggaatactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

14.53

Weight (kDa)

8.29

Isoelectric Point (pI)

54.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 290
AclI AACGTT 1 cut(s) 139
AclWI GGATC 1 cut(s) 245
AcsI RAATTY 1 cut(s) 353
AcuI CTGAAG 2 cut(s) 45, 174
AfaI GTAC 2 cut(s) 157, 264
AfeI AGCGCT 1 cut(s) 172
AfiI CCNNNNNNNGG 1 cut(s) 234
AgsI TTSAA 2 cut(s) 318, 333
AjnI CCWGG 2 cut(s) 227, 233
Alw26I GTCTC 4 cut(s) 53, 127, 181, 204
AlwI GGATC 1 cut(s) 245
Aor51HI AGCGCT 1 cut(s) 172
AoxI GGCC 2 cut(s) 181, 222
ApoI RAATTY 1 cut(s) 353
AspLEI GCGC 1 cut(s) 173
AspS9I GGNCC 4 cut(s) 182, 223, 231, 245
AsuHPI GGTGA 2 cut(s) 143, 244
AvaII GGWCC 2 cut(s) 231, 245
BccI CCATC 1 cut(s) 37
BciT130I CCWGG 2 cut(s) 229, 235
BcoDI GTCTC 4 cut(s) 53, 127, 181, 204
BfaI CTAG 2 cut(s) 168, 385
BfoI RGCGCY 1 cut(s) 174
Bme1390I CCNGG 2 cut(s) 229, 235
Bme18I GGWCC 2 cut(s) 231, 245
BmgT120I GGNCC 4 cut(s) 182, 223, 231, 245
BmiI GGNNCC 2 cut(s) 147, 225
BmrFI CCNGG 2 cut(s) 229, 235
BmsI GCATC 2 cut(s) 88, 292
BsaJI CCNNGG 1 cut(s) 227
BsaWI WCCGGW 1 cut(s) 306
BsaXI ACNNNNNCTCC 2 cut(s) 288, 318
Bsc4I CCNNNNNNNGG 1 cut(s) 234
BseBI CCWGG 2 cut(s) 229, 235
BseDI CCNNGG 1 cut(s) 227
BseGI GGATG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 234
BsgI GTGCAG 1 cut(s) 34
BshFI GGCC 2 cut(s) 183, 224
BsiSI CCGG 1 cut(s) 307
BslI CCNNNNNNNGG 1 cut(s) 234
BsmAI GTCTC 4 cut(s) 53, 127, 181, 204
BsnI GGCC 2 cut(s) 183, 224
Bsp1407I TGTACA 1 cut(s) 262
Bsp143I GATC 1 cut(s) 237
BspANI GGCC 2 cut(s) 183, 224
BspLI GGNNCC 2 cut(s) 147, 225
BspPI GGATC 1 cut(s) 245
BsrGI TGTACA 1 cut(s) 262
BssECI CCNNGG 1 cut(s) 227
BssMI GATC 1 cut(s) 237
BssNAI GTATAC 1 cut(s) 291
Bst1107I GTATAC 1 cut(s) 291
Bst2UI CCWGG 2 cut(s) 229, 235
Bst4CI ACNGT 3 cut(s) 12, 155, 215
BstAUI TGTACA 1 cut(s) 262
BstF5I GGATG 1 cut(s) 103
BstH2I RGCGCY 1 cut(s) 174
BstHHI GCGC 1 cut(s) 173
BstKTI GATC 1 cut(s) 240
BstMAI GTCTC 4 cut(s) 53, 127, 181, 204
BstMBI GATC 1 cut(s) 237
BstNI CCWGG 2 cut(s) 229, 235
BstNSI RCATGY 1 cut(s) 84
BstSCI CCNGG 2 cut(s) 227, 233
BstZ17I GTATAC 1 cut(s) 291
BsuRI GGCC 2 cut(s) 183, 224
BtsCI GGATG 1 cut(s) 103
BtsIMutI CAGTG 2 cut(s) 17, 220
CfoI GCGC 1 cut(s) 173
Cfr13I GGNCC 4 cut(s) 182, 223, 231, 245
Csp6I GTAC 2 cut(s) 156, 263
CviAII CATG 1 cut(s) 81
CviJI RGCY 3 cut(s) 47, 183, 224
CviKI_1 RGCY 3 cut(s) 47, 183, 224
CviQI GTAC 2 cut(s) 156, 263
DpnI GATC 1 cut(s) 239
DpnII GATC 1 cut(s) 237
Eco47I GGWCC 2 cut(s) 231, 245
Eco47III AGCGCT 1 cut(s) 172
Eco57I CTGAAG 2 cut(s) 45, 174
EcoRII CCWGG 2 cut(s) 227, 233
EcoT22I ATGCAT 1 cut(s) 285
FaeI CATG 1 cut(s) 84
FaiI YATR 6 cut(s) 56, 82, 127, 221, 281, 291
FatI CATG 1 cut(s) 80
FblI GTMKAC 1 cut(s) 290
FokI GGATG 1 cut(s) 110
FspBI CTAG 2 cut(s) 168, 385
GlaI GCGC 1 cut(s) 172
HaeII RGCGCY 1 cut(s) 174
HaeIII GGCC 2 cut(s) 183, 224
HapII CCGG 1 cut(s) 307
HhaI GCGC 1 cut(s) 173
Hin1II CATG 1 cut(s) 84
Hin6I GCGC 1 cut(s) 171
HinP1I GCGC 1 cut(s) 171
HpaII CCGG 1 cut(s) 307
HphI GGTGA 2 cut(s) 143, 244
Hpy166II GTNNAC 1 cut(s) 291
Hpy188I TCNGA 4 cut(s) 25, 145, 193, 242
Hpy8I GTNNAC 1 cut(s) 291
HpyAV CCTTC 1 cut(s) 70
HpyCH4III ACNGT 3 cut(s) 12, 155, 215
HpyCH4IV ACGT 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 15, 283
HpySE526I ACGT 1 cut(s) 139
Hsp92II CATG 1 cut(s) 84
HspAI GCGC 1 cut(s) 171
Kzo9I GATC 1 cut(s) 237
LpnPI CCDG 9 cut(s) 165, 192, 198, 214, 220, 241, 247, 320, 331
LweI GCATC 2 cut(s) 88, 292
MaeI CTAG 2 cut(s) 168, 385
MaeII ACGT 1 cut(s) 139
MaeIII GTNAC 1 cut(s) 341
MalI GATC 1 cut(s) 239
MboI GATC 1 cut(s) 237
MboII GAAGA 1 cut(s) 306
MluCI AATT 1 cut(s) 353
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 3 cut(s) 159, 236, 370
Mph1103I ATGCAT 1 cut(s) 285
MspI CCGG 1 cut(s) 307
MspR9I CCNGG 2 cut(s) 229, 235
MvaI CCWGG 2 cut(s) 229, 235
NdeII GATC 1 cut(s) 237
NlaIII CATG 1 cut(s) 84
NlaIV GGNNCC 2 cut(s) 147, 225
NmuCI GTSAC 1 cut(s) 341
NsiI ATGCAT 1 cut(s) 285
NspI RCATGY 1 cut(s) 84
PfoI TCCNGGA 1 cut(s) 233
Psp1406I AACGTT 1 cut(s) 139
Psp6I CCWGG 2 cut(s) 227, 233
PspGI CCWGG 2 cut(s) 227, 233
PspN4I GGNNCC 2 cut(s) 147, 225
PspPI GGNCC 4 cut(s) 182, 223, 231, 245
PsrI GAACNNNNNNTAC 2 cut(s) 148, 180
RsaI GTAC 2 cut(s) 157, 264
RsaNI GTAC 2 cut(s) 156, 263
Sau3AI GATC 1 cut(s) 237
Sau96I GGNCC 4 cut(s) 182, 223, 231, 245
ScrFI CCNGG 2 cut(s) 229, 235
SetI ASST 3 cut(s) 126, 142, 151
SfaNI GCATC 2 cut(s) 88, 292
SinI GGWCC 2 cut(s) 231, 245
Sse9I AATT 1 cut(s) 353
SspI AATATT 1 cut(s) 337
SspMI CTAG 2 cut(s) 168, 385
StyD4I CCNGG 2 cut(s) 227, 233
TaaI ACNGT 3 cut(s) 12, 155, 215
TaiI ACGT 1 cut(s) 142
TasI AATT 1 cut(s) 353
TatI WGTACW 1 cut(s) 262
TscAI CASTG 2 cut(s) 17, 220
TseFI GTSAC 1 cut(s) 341
Tsp45I GTSAC 1 cut(s) 341
TspDTI ATGAA 2 cut(s) 81, 366
TspRI CASTG 2 cut(s) 17, 220
VpaK11BI GGWCC 2 cut(s) 231, 245
XapI RAATTY 1 cut(s) 353
XceI RCATGY 1 cut(s) 84
XmiI GTMKAC 1 cut(s) 290
XspI CTAG 2 cut(s) 168, 385
Zsp2I ATGCAT 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.