Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000006

Orthogroup ID

OG0007418

Physical Location & Seq

Genomic Coordinates Forward (+)

1630574 .. 1631348

Gene Structure 775 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug06G0012300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 564 bp

ATGGCAGACGAGATAGAAGCCTTCAAATTCGTCGACTTAGATATTCTCCTCAGCATATGTGAGAGGATTTCAACATTGGTTCTGATGCTCATCTGTCCCGACTTTAAAGCTGTTGGCACATTCCTCATGATCGCAACATTCCTAAGATTGCAATACCTTGTGTTTTACCGTCTGAGTGCTATCATGCCTGAGCTGCTAGACTATTGTATTGCAGTTTTCGCTGATCGGATGATTACCGTTGTCCAAATGTTTTTAGGGTGGCCTAGTGTTTGGTATATAGTAATTATGGTTGGTTTGGGGATGGTTTCAACCATATGCACTGCTTGCAACATGTATTCCATGTATTCAATAACTCAGAAAGAGAAAGCTGAAATTGAGGAGAAGAGGTTACTTGCTATAGAAGCAATTAAAGCAGGGGCAGCCAATTCTGCGGAGCTTTTCGATTTTGTAGTCTACCACTCTGATTATTACAGAAATTATTTGAATTACTACTCTGGAGAAACAGCATATGAACTTTCTTATACAAGGATTCGGGAAGACCTCCTTGCTGATCAACTTGTATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PAR1

Protein Analysis

187

Amino Acids

21.55

Weight (kDa)

4.57

Isoelectric Point (pI)

34.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007418)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G54040 AT3G54040
fragaria_vesca	FvH4_6g12390 FvH4_6g12390
malus_domestica	MD04G1143000.v1.1 MD04G1143100.v1.1 MD12G1157300.v1.1
prunus_persica	Prupe.6G267800_v2.0.a1
pyrus_communis	pycom12g14960
rosa_chinensis	RchiOBHm_Chr3g0464221 RchiOBHm_Chr3g0464231
rosa_laevigata	RLG00000024715
rosa_multiflora	Rmu_sc0006492.1_g000025 Rmu_sc0007811.1_g000010 Rmu_sc0007811.1_g000011
rosa_roxburghii	Rroxscaffold_6G00415930
rosa_rugosa	Rorug03G0070900 Rorug06G0012300
rosa_samantha	Rh3BG132600 Rh3BG132700 Rh3CG134900 Rh3CG135000 Rh3DG134000 Rh3DG134100
rosa_wichuraiana	Rw3G010850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	33, 453
AciI	CCGC	1 cut(s)	431
AcsI	RAATTY	1 cut(s)	26
AflIII	ACRYGT	1 cut(s)	330
AgsI	TTSAA	5 cut(s)	25, 72, 309, 348, 484
AluBI	AGCT	4 cut(s)	110, 193, 368, 436
AluI	AGCT	4 cut(s)	110, 193, 368, 436
AoxI	GGCC	1 cut(s)	260
ApeKI	GCWGC	2 cut(s)	193, 419
ApoI	RAATTY	1 cut(s)	26
BbsI	GAAGAC	1 cut(s)	543
BbvCI	CCTCAGC	1 cut(s)	50
BbvI	GCAGC	2 cut(s)	180, 431
BccI	CCATC	1 cut(s)	295
BclI	TGATCA	1 cut(s)	550
BfaI	CTAG	2 cut(s)	197, 264
BfmI	CTRYAG	1 cut(s)	396
BisI	GCNGC	2 cut(s)	194, 420
BlsI	GCNGC	2 cut(s)	195, 421
BmsI	GCATC	1 cut(s)	75
BpiI	GAAGAC	1 cut(s)	543
BpmI	CTGGAG	1 cut(s)	516
Bpu10I	CCTNAGC	2 cut(s)	50, 189
BsaBI	GATNNNNATC	1 cut(s)	89
BsaXI	ACNNNNNCTCC	2 cut(s)	371, 401
Bse8I	GATNNNNATC	1 cut(s)	89
BseGI	GGATG	2 cut(s)	234, 306
BseJI	GATNNNNATC	1 cut(s)	89
BseMII	CTCAG	4 cut(s)	64, 164, 180, 368
BseRI	GAGGAG	2 cut(s)	38, 392
BseXI	GCAGC	2 cut(s)	180, 431
BshFI	GGCC	1 cut(s)	262
BslFI	GGGAC	1 cut(s)	81
BsmFI	GGGAC	1 cut(s)	81
BsnI	GGCC	1 cut(s)	262
Bsp143I	GATC	3 cut(s)	129, 223, 550
BspACI	CCGC	1 cut(s)	431
BspANI	GGCC	1 cut(s)	262
BspCNI	CTCAG	4 cut(s)	63, 165, 181, 367
BspHI	TCATGA	1 cut(s)	126
BssMI	GATC	3 cut(s)	129, 223, 550
Bst4CI	ACNGT	2 cut(s)	170, 238
Bst6I	CTCTTC	1 cut(s)	377
BstAPI	GCANNNNNTGC	1 cut(s)	324
BstC8I	GCNNGC	1 cut(s)	325
BstDEI	CTNAG	6 cut(s)	37, 50, 143, 173, 189, 354
BstF5I	GGATG	2 cut(s)	234, 306
BstKTI	GATC	3 cut(s)	132, 226, 553
BstMBI	GATC	3 cut(s)	129, 223, 550
BstMWI	GCNNNNNNNGC	7 cut(s)	193, 218, 324, 401, 410, 419, 428
BstNSI	RCATGY	1 cut(s)	334
BstSFI	CTRYAG	1 cut(s)	396
BstV1I	GCAGC	2 cut(s)	180, 431
BstV2I	GAAGAC	1 cut(s)	543
BsuRI	GGCC	1 cut(s)	262
BtsCI	GGATG	2 cut(s)	234, 306
BtsI	GCAGTG	1 cut(s)	318
BtsIMutI	CAGTG	1 cut(s)	318
Cac8I	GCNNGC	1 cut(s)	325
CciI	TCATGA	1 cut(s)	126
CviAII	CATG	4 cut(s)	127, 184, 331, 340
CviJI	RGCY	7 cut(s)	20, 110, 193, 262, 368, 422, 436
CviKI_1	RGCY	7 cut(s)	20, 110, 193, 262, 368, 422, 436
DdeI	CTNAG	6 cut(s)	37, 50, 143, 173, 189, 354
DpnI	GATC	3 cut(s)	131, 225, 552
DpnII	GATC	3 cut(s)	129, 223, 550
DraI	TTTAAA	1 cut(s)	106
Eam1104I	CTCTTC	1 cut(s)	377
EarI	CTCTTC	1 cut(s)	377
FaeI	CATG	4 cut(s)	130, 187, 334, 343
FalI	AAGNNNNNCTT	2 cut(s)	528, 560
FaqI	GGGAC	1 cut(s)	81
FatI	CATG	4 cut(s)	126, 183, 330, 339
FauNDI	CATATG	3 cut(s)	56, 314, 508
FbaI	TGATCA	1 cut(s)	550
FblI	GTMKAC	2 cut(s)	33, 453
Fnu4HI	GCNGC	2 cut(s)	194, 420
FokI	GGATG	2 cut(s)	241, 313
Fsp4HI	GCNGC	2 cut(s)	194, 420
FspBI	CTAG	2 cut(s)	197, 264
GluI	GCNGC	2 cut(s)	194, 420
GsuI	CTGGAG	1 cut(s)	516
HaeIII	GGCC	1 cut(s)	262
Hin1II	CATG	4 cut(s)	130, 187, 334, 343
HincII	GTYRAC	1 cut(s)	34
HindII	GTYRAC	1 cut(s)	34
HinfI	GANTC	1 cut(s)	529
Hpy166II	GTNNAC	2 cut(s)	34, 454
Hpy188I	TCNGA	5 cut(s)	84, 174, 228, 357, 463
Hpy188III	TCNNGA	4 cut(s)	98, 127, 495, 533
Hpy8I	GTNNAC	2 cut(s)	34, 454
Hpy99I	CGWCG	1 cut(s)	35
HpyAV	CCTTC	1 cut(s)	31
HpyCH4III	ACNGT	2 cut(s)	170, 238
HpyCH4V	TGCA	4 cut(s)	151, 212, 318, 327
HpyF10VI	GCNNNNNNNGC	7 cut(s)	193, 218, 324, 401, 410, 419, 428
HpyF3I	CTNAG	6 cut(s)	37, 50, 143, 173, 189, 354
Hsp92II	CATG	4 cut(s)	130, 187, 334, 343
Ksp22I	TGATCA	1 cut(s)	550
Kzo9I	GATC	3 cut(s)	129, 223, 550
LmnI	GCTCC	1 cut(s)	433
LpnPI	CCDG	3 cut(s)	201, 399, 480
Lsp1109I	GCAGC	2 cut(s)	180, 431
LweI	GCATC	1 cut(s)	75
MaeI	CTAG	2 cut(s)	197, 264
MaeIII	GTNAC	1 cut(s)	387
MalI	GATC	3 cut(s)	131, 225, 552
MboI	GATC	3 cut(s)	129, 223, 550
MboII	GAAGA	2 cut(s)	394, 548
MluCI	AATT	7 cut(s)	26, 282, 372, 405, 424, 475, 484
MnlI	CCTC	6 cut(s)	57, 59, 134, 370, 378, 551
MseI	TTAA	2 cut(s)	105, 408
MwoI	GCNNNNNNNGC	7 cut(s)	193, 218, 324, 401, 410, 419, 428
NdeI	CATATG	3 cut(s)	56, 314, 508
NdeII	GATC	3 cut(s)	129, 223, 550
NlaIII	CATG	4 cut(s)	130, 187, 334, 343
NspI	RCATGY	1 cut(s)	334
PagI	TCATGA	1 cut(s)	126
PciI	ACATGT	1 cut(s)	330
PfeI	GAWTC	1 cut(s)	529
PkrI	GCNGC	2 cut(s)	195, 421
PscI	ACATGT	1 cut(s)	330
SalI	GTCGAC	1 cut(s)	32
SaqAI	TTAA	2 cut(s)	105, 408
SatI	GCNGC	2 cut(s)	194, 420
Sau3AI	GATC	3 cut(s)	129, 223, 550
SetI	ASST	7 cut(s)	112, 159, 195, 370, 389, 438, 543
SfaNI	GCATC	1 cut(s)	75
SfcI	CTRYAG	1 cut(s)	396
Sse9I	AATT	7 cut(s)	26, 282, 372, 405, 424, 475, 484
SsiI	CCGC	1 cut(s)	431
SspMI	CTAG	2 cut(s)	197, 264
TaaI	ACNGT	2 cut(s)	170, 238
TaqI	TCGA	2 cut(s)	33, 441
TasI	AATT	7 cut(s)	26, 282, 372, 405, 424, 475, 484
TfiI	GAWTC	1 cut(s)	529
Tru1I	TTAA	2 cut(s)	105, 408
Tru9I	TTAA	2 cut(s)	105, 408
TscAI	CASTG	1 cut(s)	325
TseI	GCWGC	2 cut(s)	193, 419
TspDTI	ATGAA	1 cut(s)	525
TspRI	CASTG	1 cut(s)	325
XapI	RAATTY	1 cut(s)	26
XceI	RCATGY	1 cut(s)	334
XmiI	GTMKAC	2 cut(s)	33, 453
XspI	CTAG	2 cut(s)	197, 264

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.