Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007873.1

Orthogroup ID

OG0010556

Physical Location & Seq

Genomic Coordinates Forward (+)

23811 .. 24218

Gene Structure 408 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007873.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 408 bp

atgggtgcttcattgatttttgttacccatagagagcctcgacttcgactccattggtggccagggcgaagctctcgtcgcttgtctctgggaagtcccagccctctatttcaaacaggacttcacattggaacattggaaaacggtgccacgttccgctcagcctgccccttctttggcgttgccgagaacctcgtcctccaggagaagctctcgcattacttggacatggtggagcttcacctggaaaaggagatctcggtccgatcaaagtccttctttgaggctcagggccagttgcaggatttgaatgtgaagatcgttgagggatgtaatatgattcgggagcttaaggagaccattttgctgttggatgtggatttggtggactctgcgaggcagatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000139 GO:0000149 GO:0000938 GO:0001894 GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005794 GO:0005802 GO:0006810 GO:0006892 GO:0006896 GO:0006996 GO:0007010 GO:0007034 GO:0007041 GO:0008150 GO:0009507 GO:0009536 GO:0009987 GO:0012505 GO:0016020 GO:0016043 GO:0016192 GO:0016197 GO:0016482 GO:0019905 GO:0031090 GO:0031410 GO:0031974 GO:0031981 GO:0031982 GO:0031984 GO:0032501 GO:0032588 GO:0032991 GO:0040008 GO:0042147 GO:0042592 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044431 GO:0044433 GO:0044444 GO:0044446 GO:0044464 GO:0045103 GO:0045104 GO:0046907 GO:0048193 GO:0048471 GO:0048871 GO:0048872 GO:0048873 GO:0050789 GO:0050879 GO:0050881 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0060052 GO:0060249 GO:0065007 GO:0065008 GO:0070013 GO:0071840 GO:0097708 GO:0098588 GO:0098791 GO:0099023

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Vps54

Protein Analysis

135

Amino Acids

15.33

Weight (kDa)

6.51

Isoelectric Point (pI)

54.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010556)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g15181 FvH4_4g15480 FvH4_5g17630
rosa_chinensis	RchiOBHm_Chr2g0113461
rosa_laevigata	RLG00000000521 RLG00000000923 RLG00000000924 RLG00000020750
rosa_multiflora	Rmu_co8349827.1_g000001 Rmu_sc0001954.1_g000005 Rmu_sc0007873.1_g000007 Rmu_sc0008698.1_g000012
rosa_roxburghii	Rroxscaffold_4G00301430 Rroxscaffold_4G00329220
rosa_samantha	Rh1BG222200 Rh1DG248900 Rh2CG246400 Rh3BG312200 Rh4AG022700
rosa_wichuraiana	Rw2G029940 Rw4G001600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	146
AccBSI	CCGCTC	1 cut(s)	159
AciI	CCGC	1 cut(s)	157
AcoI	YGGCCR	1 cut(s)	59
AfiI	CCNNNNNNNGG	3 cut(s)	176, 250, 301
AflII	CTTAAG	1 cut(s)	350
AgsI	TTSAA	2 cut(s)	113, 310
AjnI	CCWGG	3 cut(s)	61, 201, 243
AluBI	AGCT	4 cut(s)	72, 211, 238, 349
AluI	AGCT	4 cut(s)	72, 211, 238, 349
Alw26I	GTCTC	2 cut(s)	90, 350
AoxI	GGCC	2 cut(s)	59, 292
ArsI	GACNNNNNNTTYG	2 cut(s)	61, 93
AspS9I	GGNCC	2 cut(s)	262, 292
AsuHPI	GGTGA	1 cut(s)	233
AvaII	GGWCC	1 cut(s)	262
BalI	TGGCCA	1 cut(s)	61
BanI	GGYRCC	1 cut(s)	146
BciT130I	CCWGG	3 cut(s)	63, 203, 245
BcoDI	GTCTC	2 cut(s)	90, 350
BfrI	CTTAAG	1 cut(s)	350
BglII	AGATCT	1 cut(s)	255
BlpI	GCTNAGC	1 cut(s)	160
Bme1390I	CCNGG	3 cut(s)	63, 203, 245
Bme18I	GGWCC	1 cut(s)	262
BmgT120I	GGNCC	2 cut(s)	262, 292
BmiI	GGNNCC	1 cut(s)	148
BmrFI	CCNGG	3 cut(s)	63, 203, 245
BplI	GAGNNNNNCTC	2 cut(s)	197, 229
BpmI	CTGGAG	1 cut(s)	185
Bpu10I	CCTNAGC	1 cut(s)	288
Bpu1102I	GCTNAGC	1 cut(s)	160
BsaI	GGTCTC	1 cut(s)	350
BsaJI	CCNNGG	1 cut(s)	62
BsaXI	ACNNNNNCTCC	2 cut(s)	33, 63
Bsc4I	CCNNNNNNNGG	3 cut(s)	176, 250, 301
Bse1I	ACTGG	1 cut(s)	295
BseBI	CCWGG	3 cut(s)	63, 203, 245
BseDI	CCNNGG	1 cut(s)	62
BseGI	GGATG	2 cut(s)	335, 379
BseLI	CCNNNNNNNGG	3 cut(s)	176, 250, 301
BseMII	CTCAG	2 cut(s)	174, 302
BseNI	ACTGG	1 cut(s)	295
BseYI	CCCAGC	1 cut(s)	98
BshFI	GGCC	2 cut(s)	61, 294
BshNI	GGYRCC	1 cut(s)	146
BslFI	GGGAC	1 cut(s)	81
BslI	CCNNNNNNNGG	3 cut(s)	176, 250, 301
BsmAI	GTCTC	2 cut(s)	90, 350
BsmFI	GGGAC	1 cut(s)	81
BsnI	GGCC	2 cut(s)	61, 294
Bso31I	GGTCTC	1 cut(s)	350
Bsp143I	GATC	3 cut(s)	255, 266, 318
Bsp1720I	GCTNAGC	1 cut(s)	160
BspACI	CCGC	1 cut(s)	157
BspANI	GGCC	2 cut(s)	61, 294
BspCNI	CTCAG	2 cut(s)	173, 301
BspLI	GGNNCC	1 cut(s)	148
BspT107I	GGYRCC	1 cut(s)	146
BspTI	CTTAAG	1 cut(s)	350
BspTNI	GGTCTC	1 cut(s)	350
BsrBI	CCGCTC	1 cut(s)	159
BsrI	ACTGG	1 cut(s)	295
BssECI	CCNNGG	1 cut(s)	62
BssMI	GATC	3 cut(s)	255, 266, 318
Bst2UI	CCWGG	3 cut(s)	63, 203, 245
Bst4CI	ACNGT	1 cut(s)	146
BstAFI	CTTAAG	1 cut(s)	350
BstC8I	GCNNGC	1 cut(s)	166
BstDEI	CTNAG	2 cut(s)	160, 288
BstENI	CCTNNNNNAGG	1 cut(s)	248
BstF5I	GGATG	2 cut(s)	335, 379
BstKTI	GATC	3 cut(s)	258, 269, 321
BstMAI	GTCTC	2 cut(s)	90, 350
BstMBI	GATC	3 cut(s)	255, 266, 318
BstMWI	GCNNNNNNNGC	2 cut(s)	78, 165
BstNI	CCWGG	3 cut(s)	63, 203, 245
BstSCI	CCNGG	3 cut(s)	61, 201, 243
BstX2I	RGATCY	1 cut(s)	255
BstYI	RGATCY	1 cut(s)	255
BsuRI	GGCC	2 cut(s)	61, 294
BtsCI	GGATG	2 cut(s)	335, 379
Cac8I	GCNNGC	1 cut(s)	166
Cfr13I	GGNCC	2 cut(s)	262, 292
CpoI	CGGWCCG	1 cut(s)	262
CspI	CGGWCCG	1 cut(s)	262
CviAII	CATG	1 cut(s)	229
DdeI	CTNAG	2 cut(s)	160, 288
DpnI	GATC	3 cut(s)	257, 268, 320
DpnII	GATC	3 cut(s)	255, 266, 318
EaeI	YGGCCR	1 cut(s)	59
Eco31I	GGTCTC	1 cut(s)	350
Eco47I	GGWCC	1 cut(s)	262
EcoNI	CCTNNNNNAGG	1 cut(s)	248
EcoRII	CCWGG	3 cut(s)	61, 201, 243
FaeI	CATG	1 cut(s)	232
FaiI	YATR	3 cut(s)	30, 230, 338
FalI	AAGNNNNNCTT	2 cut(s)	263, 295
FaqI	GGGAC	1 cut(s)	81
FatI	CATG	1 cut(s)	228
FokI	GGATG	2 cut(s)	342, 386
GsaI	CCCAGC	1 cut(s)	102
GsuI	CTGGAG	1 cut(s)	185
HaeIII	GGCC	2 cut(s)	61, 294
Hin1II	CATG	1 cut(s)	232
HinfI	GANTC	3 cut(s)	48, 340, 389
HphI	GGTGA	1 cut(s)	233
Hpy166II	GTNNAC	1 cut(s)	388
Hpy188I	TCNGA	1 cut(s)	266
Hpy188III	TCNNGA	1 cut(s)	344
Hpy8I	GTNNAC	1 cut(s)	388
Hpy99I	CGWCG	1 cut(s)	81
HpyAV	CCTTC	2 cut(s)	181, 286
HpyCH4III	ACNGT	1 cut(s)	146
HpyCH4IV	ACGT	1 cut(s)	152
HpyCH4V	TGCA	1 cut(s)	301
HpyF10VI	GCNNNNNNNGC	2 cut(s)	78, 165
HpyF3I	CTNAG	2 cut(s)	160, 288
HpySE526I	ACGT	1 cut(s)	152
Hsp92II	CATG	1 cut(s)	232
Kzo9I	GATC	3 cut(s)	255, 266, 318
LmnI	GCTCC	2 cut(s)	235, 346
MaeII	ACGT	1 cut(s)	152
MaeIII	GTNAC	1 cut(s)	22
MalI	GATC	3 cut(s)	257, 268, 320
MbiI	CCGCTC	1 cut(s)	159
MboI	GATC	3 cut(s)	255, 266, 318
MboII	GAAGA	1 cut(s)	328
MflI	RGATCY	1 cut(s)	255
MlsI	TGGCCA	1 cut(s)	61
MluNI	TGGCCA	1 cut(s)	61
MlyI	GAGTC	2 cut(s)	42, 383
MmeI	TCCRAC	1 cut(s)	351
MnlI	CCTC	7 cut(s)	48, 114, 203, 209, 277, 319, 390
Mox20I	TGGCCA	1 cut(s)	61
MscI	TGGCCA	1 cut(s)	61
MseI	TTAA	1 cut(s)	351
Msp20I	TGGCCA	1 cut(s)	61
MspCI	CTTAAG	1 cut(s)	350
MspR9I	CCNGG	3 cut(s)	63, 203, 245
MvaI	CCWGG	3 cut(s)	63, 203, 245
MwoI	GCNNNNNNNGC	2 cut(s)	78, 165
NdeII	GATC	3 cut(s)	255, 266, 318
NlaIII	CATG	1 cut(s)	232
NlaIV	GGNNCC	1 cut(s)	148
NmeAIII	GCCGAG	1 cut(s)	211
PfeI	GAWTC	1 cut(s)	340
PfoI	TCCNGGA	1 cut(s)	201
PleI	GAGTC	2 cut(s)	42, 383
PpsI	GAGTC	2 cut(s)	42, 383
Psp6I	CCWGG	3 cut(s)	61, 201, 243
PspFI	CCCAGC	1 cut(s)	98
PspGI	CCWGG	3 cut(s)	61, 201, 243
PspN4I	GGNNCC	1 cut(s)	148
PspPI	GGNCC	2 cut(s)	262, 292
PsuI	RGATCY	1 cut(s)	255
Rsr2I	CGGWCCG	1 cut(s)	262
RsrII	CGGWCCG	1 cut(s)	262
SaqAI	TTAA	1 cut(s)	351
Sau3AI	GATC	3 cut(s)	255, 266, 318
Sau96I	GGNCC	2 cut(s)	262, 292
SchI	GAGTC	2 cut(s)	42, 383
ScrFI	CCNGG	3 cut(s)	63, 203, 245
SetI	ASST	7 cut(s)	74, 155, 195, 213, 240, 246, 351
SinI	GGWCC	1 cut(s)	262
SmlI	CTYRAG	1 cut(s)	350
SmoI	CTYRAG	1 cut(s)	350
SsiI	CCGC	1 cut(s)	157
StyD4I	CCNGG	3 cut(s)	61, 201, 243
TaaI	ACNGT	1 cut(s)	146
TaiI	ACGT	1 cut(s)	155
TaqI	TCGA	2 cut(s)	40, 46
TaqII	GACCGA	1 cut(s)	250
TfiI	GAWTC	1 cut(s)	340
Tru1I	TTAA	1 cut(s)	351
Tru9I	TTAA	1 cut(s)	351
Vha464I	CTTAAG	1 cut(s)	350
VpaK11BI	GGWCC	1 cut(s)	262
XagI	CCTNNNNNAGG	1 cut(s)	248
XcmI	CCANNNNNNNNNTGG	1 cut(s)	367

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.