Rh4AG022700
ERF Family

belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
4435406 .. 4436565
1160 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG022700.1

Sequence Viewer

Length: 213 bp
ATGTGTTGTTGGGGACATCCAGAGCTAGAAAAGGGGGCCGACGATATCACTGTCGGAGCAGTGCATAGACAACAAAAAGACAAGTTGTCAGAGGGGATCATCCATAGAGATGTCAAGGCTGATAATATTCTACTGACACAGGATTTTGTGCCTCATATATGTGATTTTAGCAAAAGTGGCAACCGAAACAATGACTCATCACAATGTTTTTAA

Protein Analysis

70

Amino Acids

7.87

Weight (kDa)

5.67

Isoelectric Point (pI)

40.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 30 - 66 1.5e-06 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 104
AhdI GACNNNNNGTC 1 cut(s) 85
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
AlwI GGATC 1 cut(s) 104
AoxI GGCC 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 36
BfaI CTAG 1 cut(s) 26
BmeRI GACNNNNNGTC 1 cut(s) 85
BmgT120I GGNCC 1 cut(s) 36
BmiI GGNNCC 1 cut(s) 37
BseGI GGATG 2 cut(s) 16, 99
BshFI GGCC 1 cut(s) 38
BslFI GGGAC 1 cut(s) 27
BsmFI GGGAC 1 cut(s) 27
BsnI GGCC 1 cut(s) 38
Bsp143I GATC 1 cut(s) 96
BspANI GGCC 1 cut(s) 38
BspLI GGNNCC 1 cut(s) 37
BspPI GGATC 1 cut(s) 104
BssMI GATC 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 52
BstF5I GGATG 2 cut(s) 16, 99
BstKTI GATC 1 cut(s) 99
BstMBI GATC 1 cut(s) 96
BstMWI GCNNNNNNNGC 1 cut(s) 177
BsuRI GGCC 1 cut(s) 38
BtsCI GGATG 2 cut(s) 16, 99
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 2 cut(s) 48, 66
Cfr13I GGNCC 1 cut(s) 36
CviJI RGCY 3 cut(s) 25, 38, 119
CviKI_1 RGCY 3 cut(s) 25, 38, 119
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
DriI GACNNNNNGTC 1 cut(s) 85
Eam1105I GACNNNNNGTC 1 cut(s) 85
Eco32I GATATC 1 cut(s) 46
EcoRV GATATC 1 cut(s) 46
FaiI YATR 5 cut(s) 66, 105, 156, 158, 160
FaqI GGGAC 1 cut(s) 27
FokI GGATG 2 cut(s) 3, 86
FspBI CTAG 1 cut(s) 26
HaeIII GGCC 1 cut(s) 38
HinfI GANTC 1 cut(s) 194
Hpy188I TCNGA 2 cut(s) 56, 91
Hpy188III TCNNGA 1 cut(s) 20
Hpy99I CGWCG 1 cut(s) 44
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 177
Kzo9I GATC 1 cut(s) 96
LmnI GCTCC 1 cut(s) 56
LpnPI CCDG 2 cut(s) 33, 125
MaeI CTAG 1 cut(s) 26
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MlyI GAGTC 1 cut(s) 188
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 2 cut(s) 85, 162
MseI TTAA 1 cut(s) 211
MslI CAYNNNNRTG 3 cut(s) 108, 159, 202
MwoI GCNNNNNNNGC 1 cut(s) 177
NdeII GATC 1 cut(s) 96
NlaIV GGNNCC 1 cut(s) 37
PleI GAGTC 1 cut(s) 188
PpsI GAGTC 1 cut(s) 188
PspN4I GGNNCC 1 cut(s) 37
PspPI GGNCC 1 cut(s) 36
RseI CAYNNNNRTG 3 cut(s) 108, 159, 202
SaqAI TTAA 1 cut(s) 211
Sau3AI GATC 1 cut(s) 96
Sau96I GGNCC 1 cut(s) 36
SchI GAGTC 1 cut(s) 188
SetI ASST 1 cut(s) 27
SgeI CNNG 5 cut(s) 32, 38, 94, 127, 152
SmiMI CAYNNNNRTG 3 cut(s) 108, 159, 202
SspI AATATT 1 cut(s) 127
SspMI CTAG 1 cut(s) 26
TaaI ACNGT 1 cut(s) 52
Tru1I TTAA 1 cut(s) 211
Tru9I TTAA 1 cut(s) 211
TscAI CASTG 2 cut(s) 55, 66
TspRI CASTG 2 cut(s) 55, 66
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.