Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008172.1

Orthogroup ID

OG0001237

Physical Location & Seq

Genomic Coordinates Reverse (-)

2387 .. 4089

Gene Structure 1703 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008172.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1113 bp

atggtgacaaatggaaaagaatctgatgcccagatggggaatttcaccttaaaacaactacaagctgccacaaacgactttgattacaataacaaaattggagaaggtggttttggtcctgtgtacaagggtcaattgcctgatggcacagtgatagcagtgaagcagctttcctctaaatcaaggcaaggaaatcgtgaatttttaaatgagatgggcatgatatcttgtttacaacacccgaatcttgtgaaacttcatggatgctgtatcgaaggaggtcagttattgctggtctatgagtacctggagaacaataaccttgctcgagctttgtttggtcgagacactcagatcaaaatggactggccaacaaggcgtaagatttgtattgggatagcaagaggacttgcttttcttcatgaagaatctgtactaaaaattgttcaccgggacatcaaagcaactaatgtgctgcttgatgtggacttaaaccctaaaatatctgactttggactagcaaagcttgatgaagaggagaagacgcacataagcacccgagttgctgggaccatagggtacatggcaccggaatatgcactatggggtcacctgacctacaaagcagatgtttacagttttggagtagtggctctggaacttattagtgggaagaacaacaatgcttatatgccaagtgatgattgcgtttgtcttctagattgggcttgtcatgtgcaacaatctggaaatttgttggagctagttgatgagaagttagggtccgagtttgacaaaaaggaagcagagatcatgatcaaagtagctctgatatgcacaaacgcctctgcttcacttaggcctagcatgtctgaggtggtcaaaatgcttgaaggacaaatagccgttccggacgtgatccctgaaccgagtagctacagggaggatttgaggtttaaggccatgagagacctccatcggcagagggaaactgacagttcaactatgagccaaacacaaatgacagtccaaacattctgctccacctctaccacatctggcattgactcctgtgaaatcaacccaatatccgtacccccttccgagaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_8 Malectin Pkinase_Tyr

Protein Analysis

370

Amino Acids

41.05

Weight (kDa)

5.39

Isoelectric Point (pI)

40.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001237)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G29750 AT1G29750 AT1G29750
fragaria_vesca	FvH4_3g07010 FvH4_3g07010 FvH4_3g07045 FvH4_3g07045 FvH4_3g07045 FvH4_3g07045 FvH4_3g07045 FvH4_3g07045
malus_domestica	MD00G1006700.v1.1 MD00G1006800.v1.1 MD00G1006900.v1.1 MD00G1007000.v1.1 MD10G1273400.v1.1 MD10G1273600.v1.1
prunus_persica	Prupe.4G069100_v2.0.a1 Prupe.4G069200_v2.0.a1 Prupe.4G069200_v2.0.a1 Prupe.4G069200_v2.0.a1 Prupe.4G069200_v2.0.a1 Prupe.4G069200_v2.0.a1 Prupe.4G069200_v2.0.a1 Prupe.4G069200_v2.0.a1 Prupe.4G069200_v2.0.a1
pyrus_communis	pycom05g27170 pycom05g27180 pycom05g27210 pycom05g27220 pycom10g22820 pycom10g22840
rosa_chinensis	RchiOBHm_Chr5g0012071 RchiOBHm_Chr5g0012081 RchiOBHm_Chr5g0012091 RchiOBHm_Chr5g0012101
rosa_laevigata	RLG00000031884 RLG00000031885 RLG00000031889
rosa_multiflora	Rmu_sc0002519.1_g000010 Rmu_sc0002519.1_g000013 Rmu_sc0008172.1_g000001 Rmu_sc0009761.1_g000005
rosa_roxburghii	Rroxscaffold_1G00064490 Rroxscaffold_1G00064500 Rroxscaffold_1G00064510
rosa_rugosa	Rorug05G0000100 Rorug05G0000200 Rorug05G0000200
rosa_samantha	Rh5AG092900 Rh5BG089200 Rh5CG102700
rosa_wichuraiana	Rw5G008110 Rw5G008120 Rw5G008140 Rw5G008150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	586
AccIII	TCCGGA	1 cut(s)	910
AclWI	GGATC	1 cut(s)	913
AcoI	YGGCCR	1 cut(s)	368
AcsI	RAATTY	3 cut(s)	40, 200, 751
AfaI	GTAC	5 cut(s)	125, 305, 435, 581, 1095
AfiI	CCNNNNNNNGG	1 cut(s)	36
AgsI	TTSAA	2 cut(s)	893, 1002
AjiI	CACGTC	1 cut(s)	916
AjnI	CCWGG	1 cut(s)	306
AjuI	GAANNNNNNNTTGG	2 cut(s)	96, 128
AluBI	AGCT	7 cut(s)	65, 169, 332, 526, 763, 827, 936
AluI	AGCT	7 cut(s)	65, 169, 332, 526, 763, 827, 936
Alw26I	GTCTC	2 cut(s)	339, 963
AlwI	GGATC	1 cut(s)	913
Ama87I	CYCGRG	2 cut(s)	327, 558
Aor13HI	TCCGGA	1 cut(s)	910
AoxI	GGCC	3 cut(s)	368, 860, 960
ApeKI	GCWGC	3 cut(s)	65, 166, 475
ApoI	RAATTY	3 cut(s)	40, 200, 751
AspS9I	GGNCC	3 cut(s)	116, 570, 783
AsuC2I	CCSGG	1 cut(s)	452
AsuHPI	GGTGA	4 cut(s)	16, 37, 440, 602
AvaI	CYCGRG	2 cut(s)	327, 558
AvaII	GGWCC	3 cut(s)	116, 570, 783
BalI	TGGCCA	1 cut(s)	370
BanI	GGYRCC	1 cut(s)	586
BarI	GAAGNNNNNNTAC	2 cut(s)	417, 449
BbsI	GAAGAC	2 cut(s)	548, 707
BbvI	GCAGC	3 cut(s)	52, 178, 462
BccI	CCATC	4 cut(s)	28, 137, 208, 984
BceAI	ACGGC	1 cut(s)	890
BcgI	CGANNNNNNTGC	2 cut(s)	176, 210
BciT130I	CCWGG	1 cut(s)	308
BclI	TGATCA	1 cut(s)	816
BcnI	CCSGG	1 cut(s)	452
BcoDI	GTCTC	2 cut(s)	339, 963
BfaI	CTAG	4 cut(s)	518, 719, 764, 864
BfmI	CTRYAG	1 cut(s)	937
BglI	GCCNNNNNGGC	1 cut(s)	376
BisI	GCNGC	3 cut(s)	66, 167, 476
BlsI	GCNGC	3 cut(s)	67, 168, 477
Bme1390I	CCNGG	2 cut(s)	308, 452
Bme18I	GGWCC	3 cut(s)	116, 570, 783
BmeT110I	CYCGRG	2 cut(s)	327, 558
BmgBI	CACGTC	1 cut(s)	916
BmgT120I	GGNCC	3 cut(s)	116, 570, 783
BmiI	GGNNCC	3 cut(s)	571, 588, 784
BmrFI	CCNGG	2 cut(s)	308, 452
BmsI	GCATC	2 cut(s)	16, 254
BpiI	GAAGAC	2 cut(s)	548, 707
BpmI	CTGGAG	1 cut(s)	329
BpuMI	CCSGG	1 cut(s)	452
BsaBI	GATNNNNATC	1 cut(s)	815
BsaI	GGTCTC	1 cut(s)	963
BsaWI	WCCGGW	2 cut(s)	589, 910
Bsc4I	CCNNNNNNNGG	1 cut(s)	36
Bse1I	ACTGG	1 cut(s)	371
Bse8I	GATNNNNATC	1 cut(s)	815
BseAI	TCCGGA	1 cut(s)	910
BseBI	CCWGG	1 cut(s)	308
BseGI	GGATG	1 cut(s)	269
BseJI	GATNNNNATC	1 cut(s)	815
BseLI	CCNNNNNNNGG	1 cut(s)	36
BseMII	CTCAG	2 cut(s)	365, 864
BseNI	ACTGG	1 cut(s)	371
BseRI	GAGGAG	1 cut(s)	551
BseXI	GCAGC	3 cut(s)	52, 178, 462
BseYI	CCCAGC	1 cut(s)	566
BshFI	GGCC	3 cut(s)	370, 862, 962
BshNI	GGYRCC	1 cut(s)	586
BsiHKCI	CYCGRG	2 cut(s)	327, 558
BsiSI	CCGG	3 cut(s)	451, 590, 911
BslFI	GGGAC	2 cut(s)	467, 583
BslI	CCNNNNNNNGG	1 cut(s)	36
BsmAI	GTCTC	2 cut(s)	339, 963
BsmFI	GGGAC	2 cut(s)	467, 583
BsnI	GGCC	3 cut(s)	370, 862, 962
Bso31I	GGTCTC	1 cut(s)	963
BsoBI	CYCGRG	2 cut(s)	327, 558
Bsp13I	TCCGGA	1 cut(s)	910
Bsp1407I	TGTACA	1 cut(s)	123
Bsp143I	GATC	4 cut(s)	354, 810, 816, 918
BspANI	GGCC	3 cut(s)	370, 862, 962
BspCNI	CTCAG	2 cut(s)	364, 865
BspEI	TCCGGA	1 cut(s)	910
BspHI	TCATGA	2 cut(s)	421, 813
BspLI	GGNNCC	3 cut(s)	571, 588, 784
BspPI	GGATC	1 cut(s)	913
BspT107I	GGYRCC	1 cut(s)	586
BspTNI	GGTCTC	1 cut(s)	963
BsrGI	TGTACA	1 cut(s)	123
BsrI	ACTGG	1 cut(s)	371
BssMI	GATC	4 cut(s)	354, 810, 816, 918
Bst2UI	CCWGG	1 cut(s)	308
Bst4CI	ACNGT	4 cut(s)	151, 638, 998, 1027
Bst6I	CTCTTC	1 cut(s)	528
BstAUI	TGTACA	1 cut(s)	123
BstDEI	CTNAG	3 cut(s)	351, 857, 873
BstEII	GGTNACC	1 cut(s)	608
BstF5I	GGATG	1 cut(s)	269
BstKTI	GATC	4 cut(s)	357, 813, 819, 921
BstMAI	GTCTC	2 cut(s)	339, 963
BstMBI	GATC	4 cut(s)	354, 810, 816, 918
BstMWI	GCNNNNNNNGC	1 cut(s)	376
BstNI	CCWGG	1 cut(s)	308
BstNSI	RCATGY	1 cut(s)	871
BstPI	GGTNACC	1 cut(s)	608
BstSCI	CCNGG	2 cut(s)	306, 450
BstSFI	CTRYAG	1 cut(s)	937
BstV1I	GCAGC	3 cut(s)	52, 178, 462
BstV2I	GAAGAC	2 cut(s)	548, 707
BsuRI	GGCC	3 cut(s)	370, 862, 962
BtrI	CACGTC	1 cut(s)	916
BtsCI	GGATG	1 cut(s)	269
BtsI	GCAGTG	1 cut(s)	165
BtsIMutI	CAGTG	2 cut(s)	156, 165
CciI	TCATGA	2 cut(s)	421, 813
Cfr13I	GGNCC	3 cut(s)	116, 570, 783
CseI	GACGC	1 cut(s)	553
Csp6I	GTAC	5 cut(s)	124, 304, 434, 580, 1094
CviAII	CATG	8 cut(s)	220, 260, 422, 583, 734, 814, 868, 964
CviQI	GTAC	5 cut(s)	124, 304, 434, 580, 1094
DdeI	CTNAG	3 cut(s)	351, 857, 873
DpnI	GATC	4 cut(s)	356, 812, 818, 920
DpnII	GATC	4 cut(s)	354, 810, 816, 918
DraI	TTTAAA	1 cut(s)	207
EaeI	YGGCCR	1 cut(s)	368
Eam1104I	CTCTTC	1 cut(s)	528
EarI	CTCTTC	1 cut(s)	528
Eco147I	AGGCCT	1 cut(s)	862
Eco31I	GGTCTC	1 cut(s)	963
Eco32I	GATATC	1 cut(s)	225
Eco47I	GGWCC	3 cut(s)	116, 570, 783
Eco88I	CYCGRG	2 cut(s)	327, 558
Eco91I	GGTNACC	1 cut(s)	608
EcoO65I	GGTNACC	1 cut(s)	608
EcoRII	CCWGG	1 cut(s)	306
EcoRV	GATATC	1 cut(s)	225
FaeI	CATG	8 cut(s)	223, 263, 425, 586, 737, 817, 871, 967
FaqI	GGGAC	2 cut(s)	467, 583
FatI	CATG	8 cut(s)	219, 259, 421, 582, 733, 813, 867, 963
FbaI	TGATCA	1 cut(s)	816
Fnu4HI	GCNGC	3 cut(s)	66, 167, 476
FokI	GGATG	1 cut(s)	276
Fsp4HI	GCNGC	3 cut(s)	66, 167, 476
FspBI	CTAG	4 cut(s)	518, 719, 764, 864
GluI	GCNGC	3 cut(s)	66, 167, 476
GsaI	CCCAGC	1 cut(s)	570
GsuI	CTGGAG	1 cut(s)	329
HaeIII	GGCC	3 cut(s)	370, 862, 962
HapII	CCGG	3 cut(s)	451, 590, 911
HgaI	GACGC	1 cut(s)	553
Hin1II	CATG	8 cut(s)	223, 263, 425, 586, 737, 817, 871, 967
HindIII	AAGCTT	1 cut(s)	524
HinfI	GANTC	4 cut(s)	20, 244, 428, 1067
HpaII	CCGG	3 cut(s)	451, 590, 911
HphI	GGTGA	4 cut(s)	16, 37, 440, 602
Hpy166II	GTNNAC	5 cut(s)	124, 233, 448, 487, 634
Hpy188I	TCNGA	7 cut(s)	25, 354, 508, 787, 831, 874, 1105
Hpy188III	TCNNGA	8 cut(s)	197, 344, 422, 656, 719, 747, 814, 911
Hpy8I	GTNNAC	5 cut(s)	124, 233, 448, 487, 634
HpyAV	CCTTC	4 cut(s)	98, 269, 887, 1110
HpyCH4III	ACNGT	4 cut(s)	151, 638, 998, 1027
HpyCH4IV	ACGT	1 cut(s)	915
HpyCH4V	TGCA	3 cut(s)	599, 739, 837
HpyF10VI	GCNNNNNNNGC	1 cut(s)	376
HpyF3I	CTNAG	3 cut(s)	351, 857, 873
HpySE526I	ACGT	1 cut(s)	915
Hsp92II	CATG	8 cut(s)	223, 263, 425, 586, 737, 817, 871, 967
Kpn2I	TCCGGA	1 cut(s)	910
Ksp22I	TGATCA	1 cut(s)	816
Kzo9I	GATC	4 cut(s)	354, 810, 816, 918
LmnI	GCTCC	2 cut(s)	760, 1046
Lsp1109I	GCAGC	3 cut(s)	52, 178, 462
LweI	GCATC	2 cut(s)	16, 254
MaeI	CTAG	4 cut(s)	518, 719, 764, 864
MaeII	ACGT	1 cut(s)	915
MaeIII	GTNAC	2 cut(s)	4, 608
MalI	GATC	4 cut(s)	356, 812, 818, 920
MboI	GATC	4 cut(s)	354, 810, 816, 918
MboII	GAAGA	6 cut(s)	410, 437, 545, 553, 685, 707
MfeI	CAATTG	1 cut(s)	134
MlsI	TGGCCA	1 cut(s)	370
MluCI	AATT	6 cut(s)	40, 96, 134, 200, 441, 751
MluNI	TGGCCA	1 cut(s)	370
MlyI	GAGTC	1 cut(s)	1061
MmeI	TCCRAC	1 cut(s)	738
Mox20I	TGGCCA	1 cut(s)	370
MroI	TCCGGA	1 cut(s)	910
MscI	TGGCCA	1 cut(s)	370
MseI	TTAA	4 cut(s)	50, 206, 491, 957
Msp20I	TGGCCA	1 cut(s)	370
MspI	CCGG	3 cut(s)	451, 590, 911
MspR9I	CCNGG	2 cut(s)	308, 452
MunI	CAATTG	1 cut(s)	134
MvaI	CCWGG	1 cut(s)	308
MwoI	GCNNNNNNNGC	1 cut(s)	376
NciI	CCSGG	1 cut(s)	452
NdeII	GATC	4 cut(s)	354, 810, 816, 918
NlaIII	CATG	8 cut(s)	223, 263, 425, 586, 737, 817, 871, 967
NlaIV	GGNNCC	3 cut(s)	571, 588, 784
NmuCI	GTSAC	2 cut(s)	4, 608
NspI	RCATGY	1 cut(s)	871
PaeR7I	CTCGAG	1 cut(s)	327
PagI	TCATGA	2 cut(s)	421, 813
PceI	AGGCCT	1 cut(s)	862
PfeI	GAWTC	3 cut(s)	20, 244, 428
PkrI	GCNGC	3 cut(s)	67, 168, 477
PleI	GAGTC	1 cut(s)	1061
PpsI	GAGTC	1 cut(s)	1061
Psp6I	CCWGG	1 cut(s)	306
PspEI	GGTNACC	1 cut(s)	608
PspFI	CCCAGC	1 cut(s)	566
PspGI	CCWGG	1 cut(s)	306
PspN4I	GGNNCC	3 cut(s)	571, 588, 784
PspPI	GGNCC	3 cut(s)	116, 570, 783
PspXI	VCTCGAGB	1 cut(s)	327
RsaI	GTAC	5 cut(s)	125, 305, 435, 581, 1095
RsaNI	GTAC	5 cut(s)	124, 304, 434, 580, 1094
SaqAI	TTAA	4 cut(s)	50, 206, 491, 957
SatI	GCNGC	3 cut(s)	66, 167, 476
Sau3AI	GATC	4 cut(s)	354, 810, 816, 918
Sau96I	GGNCC	3 cut(s)	116, 570, 783
SchI	GAGTC	1 cut(s)	1061
ScrFI	CCNGG	2 cut(s)	308, 452
SfaNI	GCATC	2 cut(s)	16, 254
SfcI	CTRYAG	1 cut(s)	937
Sfr274I	CTCGAG	1 cut(s)	327
SinI	GGWCC	3 cut(s)	116, 570, 783
SlaI	CTCGAG	1 cut(s)	327
SmlI	CTYRAG	1 cut(s)	327
SmoI	CTYRAG	1 cut(s)	327
Sse9I	AATT	6 cut(s)	40, 96, 134, 200, 441, 751
SseBI	AGGCCT	1 cut(s)	862
SspMI	CTAG	4 cut(s)	518, 719, 764, 864
StuI	AGGCCT	1 cut(s)	862
StyD4I	CCNGG	2 cut(s)	306, 450
TaaI	ACNGT	4 cut(s)	151, 638, 998, 1027
TaiI	ACGT	1 cut(s)	918
TaqI	TCGA	3 cut(s)	273, 328, 343
TasI	AATT	6 cut(s)	40, 96, 134, 200, 441, 751
TatI	WGTACW	2 cut(s)	123, 433
TfiI	GAWTC	3 cut(s)	20, 244, 428
Tru1I	TTAA	4 cut(s)	50, 206, 491, 957
Tru9I	TTAA	4 cut(s)	50, 206, 491, 957
TscAI	CASTG	2 cut(s)	156, 165
TseFI	GTSAC	2 cut(s)	4, 608
TseI	GCWGC	3 cut(s)	65, 166, 475
Tsp45I	GTSAC	2 cut(s)	4, 608
TspDTI	ATGAA	4 cut(s)	248, 410, 438, 546
TspGWI	ACGGA	1 cut(s)	1081
TspRI	CASTG	2 cut(s)	156, 165
VpaK11BI	GGWCC	3 cut(s)	116, 570, 783
XapI	RAATTY	3 cut(s)	40, 200, 751
XbaI	TCTAGA	1 cut(s)	718
XceI	RCATGY	1 cut(s)	871
XcmI	CCANNNNNNNNNTGG	1 cut(s)	580
XhoI	CTCGAG	1 cut(s)	327
XspI	CTAG	4 cut(s)	518, 719, 764, 864

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.