Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009084.1

Orthogroup ID

OG0009170

Physical Location & Seq

Genomic Coordinates Forward (+)

55489 .. 56706

Gene Structure 1218 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009084.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1218 bp

atgatcaatgctgcaatccaagtccccaaagttccaagactccgcttcaccaaccagaaaaccgcaaccaagttggtacttgaagggctacaattgagtgatgggatctcaaacacgtaccaaatagctcaaccaaagcatcaagaatcatcaaagcactttcattctactactactagtacttcttcagctaccattcagctctatgcaatcctagaggaagtagcagatagaattgagatgcacatcaatatcggtgagcagcgcaacaactggaacgttcttctgctcaactccatcaacatgatcactctcacagcctcaatcatggctggaattgcaggcacagttggtgctggaatgcccattttggccttgaagttgtcttccgctcttttatttactgcagcctcaggaatgttgcttatcatgaacaagatccaaccttcacaactagctgaagaacagcgcaatgccacaagattgttcaagcagatccaaactcaaatccaaaacttactagcacttcgtgagccgacagaacaagatgtgaaggaaacaatggagaaagttttagctcttgacaaagcctacccacttccattgcttggagctatgcttgaaaagtaccctaaaaagtttgaggcagctgcttggtggcctaaaagtcatggagttcaaaatccaagcgcaacgaaatccaggatgggaaagactaatgggtggagtgaagatcttgaagatgaaatgagagaaattatttcagtggtgaaaagcaaagacttcgaagactacgagagattaggtaacttggcactgaagatcaacaaggttttggctatttcaggtcctttgcttactggtgttgcagccattgggtctgcttttgtgggtcacaatgatcttgcagccattgctgcagtggctgctggttcattgagcactgcagtcaatgcttttcaacatggtggtcaagttgggatggtgtttgagatgtataggaactgtgctggcttcttcaacaaattggaggatacaattgaagccacacttggagagcaagatttggagaaaagagaaaatggcgaattgtttgagatgaagattgctttggaattgggaagaagcttgcctcagcttagagaacttgcatcaaaatcagcttcatgtaggagaaatggaacagttattgacgaaatgggttcgaaactgttctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Chloroplast_duf

Protein Analysis

405

Amino Acids

44.39

Weight (kDa)

6.69

Isoelectric Point (pI)

34.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009170)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G04480 AT4G22030
fragaria_vesca	FvH4_3g01810
malus_domestica	MD05G1348900.v1.1 MD05G1349100.v1.1 MD05G1349200.v1.1 MD10G1323800.v1.1
prunus_persica	Prupe.4G018400_v2.0.a1 Prupe.8G124400_v2.0.a1
pyrus_communis	pycom05g31650 pycom05g31680 pycom10g27420
rosa_chinensis	RchiOBHm_Chr5g0002641
rosa_laevigata	RLG00000031049
rosa_multiflora	Rmu_sc0009084.1_g000014
rosa_roxburghii	Rroxscaffold_1G00073220
rosa_rugosa	Rorug04G0398000
rosa_samantha	Rh5AG021400 Rh5BG024100 Rh5CG023600 Rh5DG022500
rosa_wichuraiana	Rw5G001980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	608
AccBSI	CCGCTC	1 cut(s)	392
AciI	CCGC	3 cut(s)	43, 63, 390
AclI	AACGTT	1 cut(s)	279
AclWI	GGATC	3 cut(s)	113, 433, 490
AcuI	CTGAAG	3 cut(s)	171, 480, 839
AdeI	CACNNNGTG	1 cut(s)	530
AfaI	GTAC	4 cut(s)	78, 119, 181, 629
AfiI	CCNNNNNNNGG	1 cut(s)	608
AflIII	ACRYGT	1 cut(s)	114
AgsI	TTSAA	9 cut(s)	83, 379, 490, 623, 680, 740, 962, 1021, 1043
AhlI	ACTAGT	1 cut(s)	176
AjnI	CCWGG	1 cut(s)	701
AjuI	GAANNNNNNNTTGG	4 cut(s)	1035, 1067, 1094, 1126
Alw21I	GWGCWC	1 cut(s)	944
AlwI	GGATC	3 cut(s)	113, 433, 490
AlwNI	CAGNNNCTG	1 cut(s)	926
AoxI	GGCC	2 cut(s)	372, 659
ApeKI	GCWGC	9 cut(s)	11, 262, 407, 647, 650, 869, 908, 917, 926
Asp700I	GAANNNNTTC	1 cut(s)	1211
AspLEI	GCGC	3 cut(s)	267, 471, 692
AspS9I	GGNCC	1 cut(s)	848
AsuHPI	GGTGA	3 cut(s)	40, 269, 781
AsuII	TTCGAA	2 cut(s)	786, 1205
AvaII	GGWCC	1 cut(s)	848
AxyI	CCTNAGG	1 cut(s)	412
BbsI	GAAGAC	2 cut(s)	378, 795
Bbv12I	GWGCWC	1 cut(s)	944
BbvCI	CCTCAGC	1 cut(s)	1134
BbvI	GCAGC	8 cut(s)	274, 419, 637, 659, 881, 904, 913, 920
BccI	CCATC	4 cut(s)	95, 305, 700, 976
BcgI	CGANNNNNNTGC	2 cut(s)	766, 800
BciT130I	CCWGG	1 cut(s)	703
BciVI	GTATCC	1 cut(s)	1027
BclI	TGATCA	2 cut(s)	3, 306
BcuI	ACTAGT	1 cut(s)	176
BfaI	CTAG	4 cut(s)	177, 215, 455, 521
BfmI	CTRYAG	3 cut(s)	405, 918, 945
BfuI	GTATCC	1 cut(s)	1027
BglII	AGATCT	1 cut(s)	733
BisI	GCNGC	9 cut(s)	12, 263, 408, 648, 651, 870, 909, 918, 927
BlsI	GCNGC	9 cut(s)	13, 264, 409, 649, 652, 871, 910, 919, 928
BmcAI	AGTACT	1 cut(s)	181
Bme1390I	CCNGG	1 cut(s)	703
Bme18I	GGWCC	1 cut(s)	848
BmgT120I	GGNCC	1 cut(s)	848
BmrFI	CCNGG	1 cut(s)	703
BmsI	GCATC	3 cut(s)	148, 231, 1160
BpiI	GAAGAC	2 cut(s)	378, 795
Bpu10I	CCTNAGC	1 cut(s)	1134
Bpu14I	TTCGAA	2 cut(s)	786, 1205
BsaAI	YACGTR	1 cut(s)	117
BsaBI	GATNNNNATC	1 cut(s)	245
Bsc4I	CCNNNNNNNGG	1 cut(s)	608
Bse1I	ACTGG	2 cut(s)	278, 865
Bse21I	CCTNAGG	1 cut(s)	412
Bse3DI	GCAATG	3 cut(s)	478, 602, 912
Bse8I	GATNNNNATC	1 cut(s)	245
BseBI	CCWGG	1 cut(s)	703
BseGI	GGATG	2 cut(s)	711, 987
BseJI	GATNNNNATC	1 cut(s)	245
BseLI	CCNNNNNNNGG	1 cut(s)	608
BseMI	GCAATG	3 cut(s)	478, 602, 912
BseMII	CTCAG	2 cut(s)	426, 1148
BseNI	ACTGG	2 cut(s)	278, 865
BseXI	GCAGC	8 cut(s)	274, 419, 637, 659, 881, 904, 913, 920
BshFI	GGCC	2 cut(s)	374, 661
BsiHKAI	GWGCWC	1 cut(s)	944
BslFI	GGGAC	1 cut(s)	8
BslI	CCNNNNNNNGG	1 cut(s)	608
BsmFI	GGGAC	1 cut(s)	8
BsmI	GAATGC	1 cut(s)	366
BsnI	GGCC	2 cut(s)	374, 661
Bsp119I	TTCGAA	2 cut(s)	786, 1205
Bsp1286I	GDGCHC	1 cut(s)	944
Bsp143I	GATC	8 cut(s)	3, 105, 306, 438, 495, 733, 822, 901
BspACI	CCGC	3 cut(s)	43, 63, 390
BspANI	GGCC	2 cut(s)	374, 661
BspCNI	CTCAG	2 cut(s)	425, 1147
BspHI	TCATGA	1 cut(s)	429
BspMAI	CTGCAG	3 cut(s)	409, 922, 949
BspPI	GGATC	3 cut(s)	113, 433, 490
BspT104I	TTCGAA	2 cut(s)	786, 1205
BsrBI	CCGCTC	1 cut(s)	392
BsrDI	GCAATG	3 cut(s)	478, 602, 912
BsrI	ACTGG	2 cut(s)	278, 865
BssMI	GATC	8 cut(s)	3, 105, 306, 438, 495, 733, 822, 901
Bst2UI	CCWGG	1 cut(s)	703
Bst4CI	ACNGT	4 cut(s)	349, 1007, 1186, 1212
BstAPI	GCANNNNNTGC	3 cut(s)	914, 926, 953
BstBAI	YACGTR	1 cut(s)	117
BstBI	TTCGAA	2 cut(s)	786, 1205
BstC8I	GCNNGC	3 cut(s)	343, 1012, 1130
BstDEI	CTNAG	3 cut(s)	412, 1134, 1139
BstF5I	GGATG	2 cut(s)	711, 987
BstHHI	GCGC	3 cut(s)	267, 471, 692
BstKTI	GATC	8 cut(s)	6, 108, 309, 441, 498, 736, 825, 904
BstMBI	GATC	8 cut(s)	3, 105, 306, 438, 495, 733, 822, 901
BstMWI	GCNNNNNNNGC	6 cut(s)	338, 914, 917, 923, 926, 953
BstNI	CCWGG	1 cut(s)	703
BstSCI	CCNGG	1 cut(s)	701
BstSFI	CTRYAG	3 cut(s)	405, 918, 945
BstV1I	GCAGC	8 cut(s)	274, 419, 637, 659, 881, 904, 913, 920
BstV2I	GAAGAC	2 cut(s)	378, 795
BstX2I	RGATCY	4 cut(s)	105, 438, 495, 733
BstYI	RGATCY	4 cut(s)	105, 438, 495, 733
Bsu36I	CCTNAGG	1 cut(s)	412
BsuI	GTATCC	1 cut(s)	1027
BsuRI	GGCC	2 cut(s)	374, 661
BtsCI	GGATG	2 cut(s)	711, 987
BtsI	GCAGTG	2 cut(s)	927, 942
BtsIMutI	CAGTG	4 cut(s)	771, 815, 927, 942
Cac8I	GCNNGC	3 cut(s)	343, 1012, 1130
CaiI	CAGNNNCTG	1 cut(s)	926
CciI	TCATGA	1 cut(s)	429
CfoI	GCGC	3 cut(s)	267, 471, 692
Cfr13I	GGNCC	1 cut(s)	848
Csp6I	GTAC	4 cut(s)	77, 118, 180, 628
CspCI	CAANNNNNGTGG	2 cut(s)	585, 620
CviAII	CATG	6 cut(s)	304, 328, 430, 671, 965, 1167
CviQI	GTAC	4 cut(s)	77, 118, 180, 628
DdeI	CTNAG	3 cut(s)	412, 1134, 1139
DpnI	GATC	8 cut(s)	5, 107, 308, 440, 497, 735, 824, 903
DpnII	GATC	8 cut(s)	3, 105, 306, 438, 495, 733, 822, 901
DraIII	CACNNNGTG	1 cut(s)	530
Eco47I	GGWCC	1 cut(s)	848
Eco57I	CTGAAG	3 cut(s)	171, 480, 839
Eco81I	CCTNAGG	1 cut(s)	412
EcoO109I	RGGNCCY	1 cut(s)	848
EcoRII	CCWGG	1 cut(s)	701
FaeI	CATG	6 cut(s)	307, 331, 433, 674, 968, 1170
FaiI	YATR	9 cut(s)	207, 305, 329, 431, 617, 672, 966, 999, 1168
FalI	AAGNNNNNCTT	2 cut(s)	1035, 1067
FaqI	GGGAC	1 cut(s)	8
FatI	CATG	6 cut(s)	303, 327, 429, 670, 964, 1166
FbaI	TGATCA	2 cut(s)	3, 306
Fnu4HI	GCNGC	9 cut(s)	12, 263, 408, 648, 651, 870, 909, 918, 927
FokI	GGATG	2 cut(s)	718, 994
Fsp4HI	GCNGC	9 cut(s)	12, 263, 408, 648, 651, 870, 909, 918, 927
FspBI	CTAG	4 cut(s)	177, 215, 455, 521
GlaI	GCGC	3 cut(s)	266, 470, 691
GluI	GCNGC	9 cut(s)	12, 263, 408, 648, 651, 870, 909, 918, 927
HaeIII	GGCC	2 cut(s)	374, 661
HhaI	GCGC	3 cut(s)	267, 471, 692
Hin1II	CATG	6 cut(s)	307, 331, 433, 674, 968, 1170
Hin6I	GCGC	3 cut(s)	265, 469, 690
HinP1I	GCGC	3 cut(s)	265, 469, 690
HindIII	AAGCTT	1 cut(s)	1126
HinfI	GANTC	2 cut(s)	39, 146
HphI	GGTGA	3 cut(s)	40, 269, 781
Hpy188I	TCNGA	1 cut(s)	1217
Hpy188III	TCNNGA	6 cut(s)	143, 414, 430, 530, 581, 737
HpyAV	CCTTC	3 cut(s)	77, 456, 547
HpyCH4III	ACNGT	4 cut(s)	349, 1007, 1186, 1212
HpyCH4IV	ACGT	2 cut(s)	116, 279
HpyF10VI	GCNNNNNNNGC	6 cut(s)	338, 914, 917, 923, 926, 953
HpyF3I	CTNAG	3 cut(s)	412, 1134, 1139
HpySE526I	ACGT	2 cut(s)	116, 279
Hsp92II	CATG	6 cut(s)	307, 331, 433, 674, 968, 1170
HspAI	GCGC	3 cut(s)	265, 469, 690
Ksp22I	TGATCA	2 cut(s)	3, 306
Kzo9I	GATC	8 cut(s)	3, 105, 306, 438, 495, 733, 822, 901
LmnI	GCTCC	1 cut(s)	611
Lsp1109I	GCAGC	8 cut(s)	274, 419, 637, 659, 881, 904, 913, 920
LweI	GCATC	3 cut(s)	148, 231, 1160
MaeI	CTAG	4 cut(s)	177, 215, 455, 521
MaeII	ACGT	2 cut(s)	116, 279
MaeIII	GTNAC	2 cut(s)	806, 893
MalI	GATC	8 cut(s)	5, 107, 308, 440, 497, 735, 824, 903
MbiI	CCGCTC	1 cut(s)	392
MboI	GATC	8 cut(s)	3, 105, 306, 438, 495, 733, 822, 901
MfeI	CAATTG	2 cut(s)	92, 1038
MflI	RGATCY	4 cut(s)	105, 438, 495, 733
MhlI	GDGCHC	1 cut(s)	944
MluCI	AATT	8 cut(s)	92, 234, 336, 756, 1025, 1038, 1088, 1115
MlyI	GAGTC	1 cut(s)	33
MmeI	TCCRAC	1 cut(s)	466
MnlI	CCTC	6 cut(s)	211, 331, 421, 637, 1024, 1143
MroXI	GAANNNNTTC	1 cut(s)	1211
MslI	CAYNNNNRTG	1 cut(s)	302
MspA1I	CMGCKG	1 cut(s)	650
MspR9I	CCNGG	1 cut(s)	703
MunI	CAATTG	2 cut(s)	92, 1038
Mva1269I	GAATGC	1 cut(s)	366
MvaI	CCWGG	1 cut(s)	703
MwoI	GCNNNNNNNGC	6 cut(s)	338, 914, 917, 923, 926, 953
NdeII	GATC	8 cut(s)	3, 105, 306, 438, 495, 733, 822, 901
NlaIII	CATG	6 cut(s)	307, 331, 433, 674, 968, 1170
NmuCI	GTSAC	1 cut(s)	893
NspV	TTCGAA	2 cut(s)	786, 1205
PagI	TCATGA	1 cut(s)	429
PcsI	WCGNNNNNNNCGW	1 cut(s)	792
PctI	GAATGC	1 cut(s)	366
PdmI	GAANNNNTTC	1 cut(s)	1211
PfeI	GAWTC	1 cut(s)	146
PflMI	CCANNNNNTGG	1 cut(s)	608
PfoI	TCCNGGA	1 cut(s)	701
PkrI	GCNGC	9 cut(s)	13, 264, 409, 649, 652, 871, 910, 919, 928
PleI	GAGTC	1 cut(s)	33
PpsI	GAGTC	1 cut(s)	33
Ppu21I	YACGTR	1 cut(s)	117
PpuMI	RGGWCCY	1 cut(s)	848
Psp1406I	AACGTT	1 cut(s)	279
Psp5II	RGGWCCY	1 cut(s)	848
Psp6I	CCWGG	1 cut(s)	701
PspGI	CCWGG	1 cut(s)	701
PspPI	GGNCC	1 cut(s)	848
PspPPI	RGGWCCY	1 cut(s)	848
PstI	CTGCAG	3 cut(s)	409, 922, 949
PstNI	CAGNNNCTG	1 cut(s)	926
PsuI	RGATCY	4 cut(s)	105, 438, 495, 733
PvuII	CAGCTG	1 cut(s)	650
RsaI	GTAC	4 cut(s)	78, 119, 181, 629
RsaNI	GTAC	4 cut(s)	77, 118, 180, 628
RseI	CAYNNNNRTG	1 cut(s)	302
SatI	GCNGC	9 cut(s)	12, 263, 408, 648, 651, 870, 909, 918, 927
Sau3AI	GATC	8 cut(s)	3, 105, 306, 438, 495, 733, 822, 901
Sau96I	GGNCC	1 cut(s)	848
ScaI	AGTACT	1 cut(s)	181
SchI	GAGTC	1 cut(s)	33
ScrFI	CCNGG	1 cut(s)	703
SduI	GDGCHC	1 cut(s)	944
SfaNI	GCATC	3 cut(s)	148, 231, 1160
SfcI	CTRYAG	3 cut(s)	405, 918, 945
SfuI	TTCGAA	2 cut(s)	786, 1205
SinI	GGWCC	1 cut(s)	848
SmiMI	CAYNNNNRTG	1 cut(s)	302
SpeI	ACTAGT	1 cut(s)	176
Sse9I	AATT	8 cut(s)	92, 234, 336, 756, 1025, 1038, 1088, 1115
SsiI	CCGC	3 cut(s)	43, 63, 390
SspMI	CTAG	4 cut(s)	177, 215, 455, 521
StyD4I	CCNGG	1 cut(s)	701
TaaI	ACNGT	4 cut(s)	349, 1007, 1186, 1212
TaiI	ACGT	2 cut(s)	119, 282
TaqI	TCGA	2 cut(s)	786, 1205
TasI	AATT	8 cut(s)	92, 234, 336, 756, 1025, 1038, 1088, 1115
TatI	WGTACW	1 cut(s)	179
TfiI	GAWTC	1 cut(s)	146
TscAI	CASTG	4 cut(s)	771, 822, 927, 949
TseFI	GTSAC	1 cut(s)	893
TseI	GCWGC	9 cut(s)	11, 262, 407, 647, 650, 869, 908, 917, 926
Tsp45I	GTSAC	1 cut(s)	893
TspDTI	ATGAA	6 cut(s)	152, 446, 759, 924, 1115, 1155
TspRI	CASTG	4 cut(s)	771, 822, 927, 949
Van91I	CCANNNNNTGG	1 cut(s)	608
VpaK11BI	GGWCC	1 cut(s)	848
XcmI	CCANNNNNNNNNTGG	1 cut(s)	919
XmnI	GAANNNNTTC	1 cut(s)	1211
XspI	CTAG	4 cut(s)	177, 215, 455, 521
ZrmI	AGTACT	1 cut(s)	181

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.