Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009404.1

Orthogroup ID

OG0006537

Physical Location & Seq

Genomic Coordinates Forward (+)

8926 .. 14042

Gene Structure 5117 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009404.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 843 bp

atgagcagcccagcagtacctttgaggcttttcttgcttctaacccccaccattactccccaatatccattacacttaccctcctcctccaagttcctcaaatccttctcctcctcctcctcctctctctcatctcatcaaacatgtgcctggaacacaacctcatctcactccaaacgccgcaagtggctttgcggacaaatgagaagagatcaagatattgataatcgatcaactgaagacaagagtggcatgaacatgtttggttccgatgaagaaataggcacccaaatcccaactcaagctcaatctgttgttgaaggatccggagcagttatggtttcagagtttagacctgcagctgatgtggattatctacaggagttattagccattcagcaacaaggccccagatcaattggcttttttgggacccggaatatgggattcatgcatcaagaacttattgagatacttagttatgcgatggttatcactaaaaatcacatttatacatcaggggcatctggtactaatgcagctgttatcaggggtgctttaagagcagagaaaccagaactgcttactgtaatcttgcctcaaagcttaaaaaagcaacctccagagagccaggaattattgtcaaaagtcaagaatgtgatagagaagcctcacaatgatcatctaccgctgctagaagccagcaggttgtgcaatatggacatcatttcacatgtacagcaagtaatatgctttgcgttccatgacagtaaattgttaatggaaacatgtcaagaggcaaaaaatctccgcaaaattgtgacgctgttctacctggattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

280

Amino Acids

31.27

Weight (kDa)

7.71

Isoelectric Point (pI)

61.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006537)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43945 AT3G59870
fragaria_vesca	FvH4_1g00160 FvH4_1g00160 FvH4_1g00160 FvH4_1g00160
malus_domestica	MD00G1087500.v1.1 MD15G1143300.v1.1
prunus_persica	Prupe.7G269700_v2.0.a1 Prupe.7G269700_v2.0.a1
pyrus_communis	pycom15g12940 pycom290g00220
rosa_chinensis	RchiOBHm_Chr2g0084451
rosa_laevigata	RLG00000015619
rosa_multiflora	Rmu_co8449065.1_g000001 Rmu_sc0009404.1_g000003
rosa_roxburghii	Rroxscaffold_2G00156050
rosa_rugosa	Rorug01G0454100 Rorug01G0454100 Rorug01G0454100 Rorug01G0454100
rosa_samantha	Rh2AG002200 Rh2BG001800 Rh2CG002100 Rh2DG002300
rosa_wichuraiana	Rw2G000190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	364, 696
AccB1I	GGYRCC	1 cut(s)	284
AccIII	TCCGGA	1 cut(s)	326
AciI	CCGC	4 cut(s)	181, 195, 689, 811
AclWI	GGATC	2 cut(s)	318, 331
AcuI	CTGAAG	1 cut(s)	258
AfaI	GTAC	3 cut(s)	18, 532, 738
AfiI	CCNNNNNNNGG	1 cut(s)	442
AflIII	ACRYGT	4 cut(s)	143, 258, 733, 788
AgsI	TTSAA	1 cut(s)	320
AjnI	CCWGG	3 cut(s)	149, 630, 834
AluBI	AGCT	4 cut(s)	305, 362, 542, 606
AluI	AGCT	4 cut(s)	305, 362, 542, 606
AlwI	GGATC	2 cut(s)	318, 331
Aor13HI	TCCGGA	1 cut(s)	326
AoxI	GGCC	1 cut(s)	406
ApeKI	GCWGC	4 cut(s)	6, 359, 539, 691
AspS9I	GGNCC	2 cut(s)	407, 432
AsuC2I	CCSGG	1 cut(s)	436
AvaII	GGWCC	1 cut(s)	432
BamHI	GGATCC	1 cut(s)	323
BanI	GGYRCC	1 cut(s)	284
BbsI	GAAGAC	1 cut(s)	246
BbvI	GCAGC	4 cut(s)	18, 371, 551, 678
BccI	CCATC	1 cut(s)	481
BciT130I	CCWGG	3 cut(s)	151, 632, 836
BclI	TGATCA	1 cut(s)	679
BcnI	CCSGG	1 cut(s)	436
BfaI	CTAG	1 cut(s)	695
BfmI	CTRYAG	2 cut(s)	357, 377
BfuAI	ACCTGC	2 cut(s)	364, 696
BisI	GCNGC	5 cut(s)	7, 181, 360, 540, 692
BlsI	GCNGC	5 cut(s)	8, 182, 361, 541, 693
Bme1390I	CCNGG	4 cut(s)	151, 436, 632, 836
Bme18I	GGWCC	1 cut(s)	432
BmgT120I	GGNCC	2 cut(s)	407, 432
BmiI	GGNNCC	6 cut(s)	268, 286, 325, 409, 433, 434
BmrFI	CCNGG	4 cut(s)	151, 436, 632, 836
BmsI	GCATC	2 cut(s)	463, 533
BpiI	GAAGAC	1 cut(s)	246
BpmI	CTGGAG	1 cut(s)	606
BpuEI	CTTGAG	1 cut(s)	285
BpuMI	CCSGG	1 cut(s)	436
Bsa29I	ATCGAT	1 cut(s)	229
BsaBI	GATNNNNATC	1 cut(s)	491
BsaWI	WCCGGW	1 cut(s)	326
BsaXI	ACNNNNNCTCC	4 cut(s)	40, 65, 70, 95
Bsc4I	CCNNNNNNNGG	1 cut(s)	442
Bse8I	GATNNNNATC	1 cut(s)	491
BseAI	TCCGGA	1 cut(s)	326
BseBI	CCWGG	3 cut(s)	151, 632, 836
BseCI	ATCGAT	1 cut(s)	229
BseJI	GATNNNNATC	1 cut(s)	491
BseLI	CCNNNNNNNGG	1 cut(s)	442
BseRI	GAGGAG	7 cut(s)	73, 76, 100, 103, 106, 109, 112
BseXI	GCAGC	4 cut(s)	18, 371, 551, 678
BseYI	CCCAGC	1 cut(s)	10
BshFI	GGCC	1 cut(s)	408
BshNI	GGYRCC	1 cut(s)	284
BshVI	ATCGAT	1 cut(s)	229
BsiSI	CCGG	2 cut(s)	327, 436
BslFI	GGGAC	1 cut(s)	445
BslI	CCNNNNNNNGG	1 cut(s)	442
BsmFI	GGGAC	1 cut(s)	445
BsnI	GGCC	1 cut(s)	408
Bsp13I	TCCGGA	1 cut(s)	326
Bsp1407I	TGTACA	1 cut(s)	736
Bsp143I	GATC	5 cut(s)	211, 230, 323, 413, 679
BspACI	CCGC	4 cut(s)	181, 195, 689, 811
BspANI	GGCC	1 cut(s)	408
BspDI	ATCGAT	1 cut(s)	229
BspEI	TCCGGA	1 cut(s)	326
BspLI	GGNNCC	6 cut(s)	268, 286, 325, 409, 433, 434
BspMAI	CTGCAG	1 cut(s)	361
BspMI	ACCTGC	2 cut(s)	364, 696
BspPI	GGATC	2 cut(s)	318, 331
BspT107I	GGYRCC	1 cut(s)	284
BsrGI	TGTACA	1 cut(s)	736
BssMI	GATC	5 cut(s)	211, 230, 323, 413, 679
Bst2UI	CCWGG	3 cut(s)	151, 632, 836
Bst4CI	ACNGT	2 cut(s)	589, 770
Bst6I	CTCTTC	1 cut(s)	202
BstAPI	GCANNNNNTGC	1 cut(s)	711
BstAUI	TGTACA	1 cut(s)	736
BstC8I	GCNNGC	1 cut(s)	703
BstDEI	CTNAG	1 cut(s)	476
BstKTI	GATC	5 cut(s)	214, 233, 326, 416, 682
BstMBI	GATC	5 cut(s)	211, 230, 323, 413, 679
BstMWI	GCNNNNNNNGC	3 cut(s)	34, 563, 711
BstNI	CCWGG	3 cut(s)	151, 632, 836
BstNSI	RCATGY	4 cut(s)	147, 262, 737, 792
BstSCI	CCNGG	4 cut(s)	149, 434, 630, 834
BstSFI	CTRYAG	2 cut(s)	357, 377
BstV1I	GCAGC	4 cut(s)	18, 371, 551, 678
BstV2I	GAAGAC	1 cut(s)	246
BstX2I	RGATCY	1 cut(s)	323
BstYI	RGATCY	1 cut(s)	323
Bsu15I	ATCGAT	1 cut(s)	229
BsuRI	GGCC	1 cut(s)	408
BsuTUI	ATCGAT	1 cut(s)	229
BtgZI	GCGATG	1 cut(s)	500
BveI	ACCTGC	2 cut(s)	364, 696
Cac8I	GCNNGC	1 cut(s)	703
Cfr13I	GGNCC	2 cut(s)	407, 432
ClaI	ATCGAT	1 cut(s)	229
CseI	GACGC	1 cut(s)	832
Csp6I	GTAC	3 cut(s)	17, 531, 737
CviAII	CATG	7 cut(s)	144, 253, 259, 451, 734, 764, 789
CviQI	GTAC	3 cut(s)	17, 531, 737
DdeI	CTNAG	1 cut(s)	476
DpnI	GATC	5 cut(s)	213, 232, 325, 415, 681
DpnII	GATC	5 cut(s)	211, 230, 323, 413, 679
Eam1104I	CTCTTC	1 cut(s)	202
EarI	CTCTTC	1 cut(s)	202
Eco47I	GGWCC	1 cut(s)	432
Eco57I	CTGAAG	1 cut(s)	258
EcoO109I	RGGNCCY	2 cut(s)	407, 432
EcoRII	CCWGG	3 cut(s)	149, 630, 834
EcoT22I	ATGCAT	1 cut(s)	456
FaeI	CATG	7 cut(s)	147, 256, 262, 454, 737, 767, 792
FaqI	GGGAC	1 cut(s)	445
FatI	CATG	7 cut(s)	143, 252, 258, 450, 733, 763, 788
FbaI	TGATCA	1 cut(s)	679
Fnu4HI	GCNGC	5 cut(s)	7, 181, 360, 540, 692
Fsp4HI	GCNGC	5 cut(s)	7, 181, 360, 540, 692
FspBI	CTAG	1 cut(s)	695
GluI	GCNGC	5 cut(s)	7, 181, 360, 540, 692
GsaI	CCCAGC	1 cut(s)	14
GsuI	CTGGAG	1 cut(s)	606
HaeIII	GGCC	1 cut(s)	408
HapII	CCGG	2 cut(s)	327, 436
HgaI	GACGC	1 cut(s)	832
Hin1II	CATG	7 cut(s)	147, 256, 262, 454, 737, 767, 792
HindIII	AAGCTT	1 cut(s)	604
HinfI	GANTC	1 cut(s)	447
HpaII	CCGG	2 cut(s)	327, 436
Hpy188I	TCNGA	2 cut(s)	271, 346
Hpy188III	TCNNGA	6 cut(s)	215, 327, 458, 623, 652, 794
HpyAV	CCTTC	2 cut(s)	115, 314
HpyCH4III	ACNGT	2 cut(s)	589, 770
HpyCH4V	TGCA	4 cut(s)	359, 454, 539, 714
HpyF10VI	GCNNNNNNNGC	3 cut(s)	34, 563, 711
HpyF3I	CTNAG	1 cut(s)	476
Hsp92II	CATG	7 cut(s)	147, 256, 262, 454, 737, 767, 792
KflI	GGGWCCC	1 cut(s)	432
Kpn2I	TCCGGA	1 cut(s)	326
Ksp22I	TGATCA	1 cut(s)	679
Kzo9I	GATC	5 cut(s)	211, 230, 323, 413, 679
LmnI	GCTCC	1 cut(s)	329
Lsp1109I	GCAGC	4 cut(s)	18, 371, 551, 678
LweI	GCATC	2 cut(s)	463, 533
MaeI	CTAG	1 cut(s)	695
MaeIII	GTNAC	1 cut(s)	820
MalI	GATC	5 cut(s)	213, 232, 325, 415, 681
MboI	GATC	5 cut(s)	211, 230, 323, 413, 679
MboII	GAAGA	3 cut(s)	219, 251, 287
MfeI	CAATTG	1 cut(s)	417
MflI	RGATCY	1 cut(s)	323
MluCI	AATT	4 cut(s)	417, 635, 773, 816
Mph1103I	ATGCAT	1 cut(s)	456
MroI	TCCGGA	1 cut(s)	326
MseI	TTAA	4 cut(s)	560, 608, 779, 841
MslI	CAYNNNNRTG	1 cut(s)	257
MspA1I	CMGCKG	3 cut(s)	362, 542, 691
MspI	CCGG	2 cut(s)	327, 436
MspR9I	CCNGG	4 cut(s)	151, 436, 632, 836
MunI	CAATTG	1 cut(s)	417
MvaI	CCWGG	3 cut(s)	151, 632, 836
MwoI	GCNNNNNNNGC	3 cut(s)	34, 563, 711
NciI	CCSGG	1 cut(s)	436
NdeII	GATC	5 cut(s)	211, 230, 323, 413, 679
NlaIII	CATG	7 cut(s)	147, 256, 262, 454, 737, 767, 792
NlaIV	GGNNCC	6 cut(s)	268, 286, 325, 409, 433, 434
NmuCI	GTSAC	1 cut(s)	820
NsiI	ATGCAT	1 cut(s)	456
NspI	RCATGY	4 cut(s)	147, 262, 737, 792
PciI	ACATGT	4 cut(s)	143, 258, 733, 788
PfeI	GAWTC	1 cut(s)	447
PkrI	GCNGC	5 cut(s)	8, 182, 361, 541, 693
PpuMI	RGGWCCY	1 cut(s)	432
PscI	ACATGT	4 cut(s)	143, 258, 733, 788
Psp5II	RGGWCCY	1 cut(s)	432
Psp6I	CCWGG	3 cut(s)	149, 630, 834
PspFI	CCCAGC	1 cut(s)	10
PspGI	CCWGG	3 cut(s)	149, 630, 834
PspN4I	GGNNCC	6 cut(s)	268, 286, 325, 409, 433, 434
PspPI	GGNCC	2 cut(s)	407, 432
PspPPI	RGGWCCY	1 cut(s)	432
PstI	CTGCAG	1 cut(s)	361
PsuI	RGATCY	1 cut(s)	323
PvuII	CAGCTG	2 cut(s)	362, 542
RsaI	GTAC	3 cut(s)	18, 532, 738
RsaNI	GTAC	3 cut(s)	17, 531, 737
RseI	CAYNNNNRTG	1 cut(s)	257
SaqAI	TTAA	4 cut(s)	560, 608, 779, 841
SatI	GCNGC	5 cut(s)	7, 181, 360, 540, 692
Sau3AI	GATC	5 cut(s)	211, 230, 323, 413, 679
Sau96I	GGNCC	2 cut(s)	407, 432
ScrFI	CCNGG	4 cut(s)	151, 436, 632, 836
SfaNI	GCATC	2 cut(s)	463, 533
SfcI	CTRYAG	2 cut(s)	357, 377
SinI	GGWCC	1 cut(s)	432
SmiMI	CAYNNNNRTG	1 cut(s)	257
SmlI	CTYRAG	1 cut(s)	300
SmoI	CTYRAG	1 cut(s)	300
Sse9I	AATT	4 cut(s)	417, 635, 773, 816
SsiI	CCGC	4 cut(s)	181, 195, 689, 811
SspMI	CTAG	1 cut(s)	695
StyD4I	CCNGG	4 cut(s)	149, 434, 630, 834
TaaI	ACNGT	2 cut(s)	589, 770
TaqI	TCGA	1 cut(s)	229
TasI	AATT	4 cut(s)	417, 635, 773, 816
TatI	WGTACW	1 cut(s)	736
TauI	GCSGC	1 cut(s)	183
TfiI	GAWTC	1 cut(s)	447
Tru1I	TTAA	4 cut(s)	560, 608, 779, 841
Tru9I	TTAA	4 cut(s)	560, 608, 779, 841
TseFI	GTSAC	1 cut(s)	820
TseI	GCWGC	4 cut(s)	6, 359, 539, 691
Tsp45I	GTSAC	1 cut(s)	820
TspDTI	ATGAA	3 cut(s)	269, 288, 439
VpaK11BI	GGWCC	1 cut(s)	432
XceI	RCATGY	4 cut(s)	147, 262, 737, 792
XspI	CTAG	1 cut(s)	695
Zsp2I	ATGCAT	1 cut(s)	456

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.