Rmu_sc0009629.1_g000013

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009629.1
Physical Location & Seq
Forward (+)
51515 .. 52300
786 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009629.1_g000013.1.cds

Sequence Viewer

Length: 786 bp
ctgtgccgcgatgggaaagttgaggatgcagtgaatgtgttgaagattatgaaggaaaaggggttaactccggatgcatatagttatgatccattgatttcaactttctgcaaagaagggaggttagatttagcaatagagtttttggattgtatgatatctgatggttgcttgcccgatattgtgaactacaatacaatcttggctgctttgtgcaagaatgggagtgctgatcaggctttgcaaatcttcgagaacttgggtgaagtcggttgtcctccaaatgtgagttcctacaacacaatgttcagtgcattgtggaattgtggagatagagtaagagctttgggaatggtatcagacatggtaagcaaaggaattgagcctgatgagatcacatacaattcgcttatatcgtgtctgtgcagagatgggatggtaaatgaggcaattgggttgttggtagacatggaaactggtggttttcagcctacagttatcacttacaatattgttcttcttgggttgagcaaggctcggaggattatcgatgccattgaagtgttcacagcaatggttgaaaagggttgccggcctaacgaaactacttacattttgctgattgaaggaattggatttgcaggatggcgagctgaagctatggagcttgcaaaatctgtttatagtttaagggctatttcggaagattccttcaaacgcttgaacaggacctttcccatgcttgatgtttacaaagagcttactctgtctgagattaggaactag

Protein Analysis

261

Amino Acids

28.86

Weight (kDa)

4.64

Isoelectric Point (pI)

35.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 465
AccII CGCG 1 cut(s) 9
AccIII TCCGGA 1 cut(s) 70
AciI CCGC 1 cut(s) 7
AclWI GGATC 1 cut(s) 83
AcuI CTGAAG 1 cut(s) 675
AgsI TTSAA 7 cut(s) 43, 102, 560, 581, 626, 715, 724
AjuI GAANNNNNNNTTGG 2 cut(s) 274, 306
AluBI AGCT 5 cut(s) 344, 653, 659, 667, 760
AluI AGCT 5 cut(s) 344, 653, 659, 667, 760
AlwI GGATC 1 cut(s) 83
Aor13HI TCCGGA 1 cut(s) 70
AoxI GGCC 1 cut(s) 593
ApeKI GCWGC 1 cut(s) 206
AspS9I GGNCC 1 cut(s) 729
AsuHPI GGTGA 1 cut(s) 275
AvaII GGWCC 1 cut(s) 729
BbvI GCAGC 1 cut(s) 193
BccI CCATC 5 cut(s) 5, 158, 425, 430, 639
BclI TGATCA 1 cut(s) 232
BfaI CTAG 1 cut(s) 784
BfmI CTRYAG 1 cut(s) 492
BisI GCNGC 2 cut(s) 7, 207
BlsI GCNGC 2 cut(s) 8, 208
Bme18I GGWCC 1 cut(s) 729
BmgT120I GGNCC 1 cut(s) 729
BmsI GCATC 3 cut(s) 16, 64, 541
BplI GAGNNNNNCTC 2 cut(s) 520, 552
Bsa29I ATCGAT 1 cut(s) 549
BsaWI WCCGGW 1 cut(s) 70
BsaXI ACNNNNNCTCC 2 cut(s) 321, 351
Bse118I RCCGGY 1 cut(s) 591
Bse1I ACTGG 1 cut(s) 481
Bse3DI GCAATG 1 cut(s) 579
BseAI TCCGGA 1 cut(s) 70
BseCI ATCGAT 1 cut(s) 549
BseGI GGATG 4 cut(s) 31, 79, 441, 650
BseMI GCAATG 1 cut(s) 579
BseMII CTCAG 1 cut(s) 762
BseNI ACTGG 1 cut(s) 481
BseXI GCAGC 1 cut(s) 193
BsgI GTGCAG 1 cut(s) 445
Bsh1236I CGCG 1 cut(s) 9
BshFI GGCC 1 cut(s) 595
BshVI ATCGAT 1 cut(s) 549
BsiSI CCGG 2 cut(s) 71, 592
BsnI GGCC 1 cut(s) 595
Bsp13I TCCGGA 1 cut(s) 70
Bsp143I GATC 3 cut(s) 88, 232, 393
BspACI CCGC 1 cut(s) 7
BspANI GGCC 1 cut(s) 595
BspCNI CTCAG 1 cut(s) 763
BspDI ATCGAT 1 cut(s) 549
BspEI TCCGGA 1 cut(s) 70
BspFNI CGCG 1 cut(s) 9
BspPI GGATC 1 cut(s) 83
BsrDI GCAATG 1 cut(s) 579
BsrFI RCCGGY 1 cut(s) 591
BsrI ACTGG 1 cut(s) 481
BssAI RCCGGY 1 cut(s) 591
BssMI GATC 3 cut(s) 88, 232, 393
Bst4CI ACNGT 1 cut(s) 496
BstC8I GCNNGC 4 cut(s) 173, 593, 651, 669
BstDEI CTNAG 1 cut(s) 771
BstF5I GGATG 4 cut(s) 31, 79, 441, 650
BstFNI CGCG 1 cut(s) 9
BstKTI GATC 3 cut(s) 91, 235, 396
BstMBI GATC 3 cut(s) 88, 232, 393
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstSFI CTRYAG 1 cut(s) 492
BstUI CGCG 1 cut(s) 9
BstV1I GCAGC 1 cut(s) 193
Bsu15I ATCGAT 1 cut(s) 549
BsuRI GGCC 1 cut(s) 595
BsuTUI ATCGAT 1 cut(s) 549
BtgZI GCGATG 1 cut(s) 24
BtsCI GGATG 4 cut(s) 31, 79, 441, 650
BtsI GCAGTG 1 cut(s) 36
BtsIMutI CAGTG 2 cut(s) 36, 316
Cac8I GCNNGC 4 cut(s) 173, 593, 651, 669
Cfr10I RCCGGY 1 cut(s) 591
Cfr13I GGNCC 1 cut(s) 729
ClaI ATCGAT 1 cut(s) 549
CviAII CATG 3 cut(s) 364, 469, 739
DdeI CTNAG 1 cut(s) 771
DpnI GATC 3 cut(s) 90, 234, 395
DpnII GATC 3 cut(s) 88, 232, 393
Eco32I GATATC 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 729
Eco57I CTGAAG 1 cut(s) 675
EcoO109I RGGNCCY 1 cut(s) 729
EcoRV GATATC 1 cut(s) 159
EcoT22I ATGCAT 1 cut(s) 79
FaeI CATG 3 cut(s) 367, 472, 742
FatI CATG 3 cut(s) 363, 468, 738
FbaI TGATCA 1 cut(s) 232
FblI GTMKAC 1 cut(s) 465
Fnu4HI GCNGC 2 cut(s) 7, 207
FokI GGATG 4 cut(s) 38, 86, 448, 657
Fsp4HI GCNGC 2 cut(s) 7, 207
FspBI CTAG 1 cut(s) 784
GluI GCNGC 2 cut(s) 7, 207
HaeIII GGCC 1 cut(s) 595
HapII CCGG 2 cut(s) 71, 592
Hin1II CATG 3 cut(s) 367, 472, 742
HincII GTYRAC 1 cut(s) 66
HindII GTYRAC 1 cut(s) 66
HinfI GANTC 1 cut(s) 707
HpaI GTTAAC 1 cut(s) 66
HpaII CCGG 2 cut(s) 71, 592
HphI GGTGA 1 cut(s) 275
Hpy166II GTNNAC 5 cut(s) 66, 187, 466, 567, 751
Hpy188I TCNGA 5 cut(s) 163, 361, 540, 703, 772
Hpy188III TCNNGA 2 cut(s) 71, 253
Hpy8I GTNNAC 5 cut(s) 66, 187, 466, 567, 751
HpyAV CCTTC 4 cut(s) 46, 110, 620, 721
HpyCH4III ACNGT 1 cut(s) 496
HpyCH4V TGCA 9 cut(s) 29, 77, 111, 216, 244, 314, 426, 641, 671
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
HpyF3I CTNAG 1 cut(s) 771
Hsp92II CATG 3 cut(s) 367, 472, 742
Kpn2I TCCGGA 1 cut(s) 70
KroI GCCGGC 1 cut(s) 591
KroNI GCCGGC 1 cut(s) 593
Ksp22I TGATCA 1 cut(s) 232
KspAI GTTAAC 1 cut(s) 66
Kzo9I GATC 3 cut(s) 88, 232, 393
LmnI GCTCC 1 cut(s) 664
LpnPI CCDG 7 cut(s) 84, 221, 399, 462, 605, 627, 712
Lsp1109I GCAGC 1 cut(s) 193
LweI GCATC 3 cut(s) 16, 64, 541
MaeI CTAG 1 cut(s) 784
MalI GATC 3 cut(s) 90, 234, 395
MboI GATC 3 cut(s) 88, 232, 393
MboII GAAGA 4 cut(s) 55, 241, 509, 716
MfeI CAATTG 1 cut(s) 450
MluCI AATT 5 cut(s) 322, 378, 403, 450, 630
MnlI CCTC 5 cut(s) 16, 114, 288, 439, 534
Mph1103I ATGCAT 1 cut(s) 79
MroI TCCGGA 1 cut(s) 70
MroNI GCCGGC 1 cut(s) 591
MseI TTAA 2 cut(s) 65, 689
MslI CAYNNNNRTG 2 cut(s) 560, 572
MspI CCGG 2 cut(s) 71, 592
MunI CAATTG 1 cut(s) 450
MvnI CGCG 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 236
NaeI GCCGGC 1 cut(s) 593
NdeII GATC 3 cut(s) 88, 232, 393
NgoMIV GCCGGC 1 cut(s) 591
NlaIII CATG 3 cut(s) 367, 472, 742
NsiI ATGCAT 1 cut(s) 79
PcsI WCGNNNNNNNCGW 1 cut(s) 413
PdiI GCCGGC 1 cut(s) 593
PfeI GAWTC 1 cut(s) 707
PkrI GCNGC 2 cut(s) 8, 208
PpuMI RGGWCCY 1 cut(s) 729
Psp5II RGGWCCY 1 cut(s) 729
PspPI GGNCC 1 cut(s) 729
PspPPI RGGWCCY 1 cut(s) 729
RseI CAYNNNNRTG 2 cut(s) 560, 572
SaqAI TTAA 2 cut(s) 65, 689
SatI GCNGC 2 cut(s) 7, 207
Sau3AI GATC 3 cut(s) 88, 232, 393
Sau96I GGNCC 1 cut(s) 729
SetI ASST 7 cut(s) 125, 346, 655, 661, 669, 734, 762
SfaNI GCATC 3 cut(s) 16, 64, 541
SfcI CTRYAG 1 cut(s) 492
SinI GGWCC 1 cut(s) 729
SmiMI CAYNNNNRTG 2 cut(s) 560, 572
Sse9I AATT 5 cut(s) 322, 378, 403, 450, 630
SsiI CCGC 1 cut(s) 7
SspI AATATT 1 cut(s) 511
SspMI CTAG 1 cut(s) 784
TaaI ACNGT 1 cut(s) 496
TaqI TCGA 2 cut(s) 252, 549
TasI AATT 5 cut(s) 322, 378, 403, 450, 630
TauI GCSGC 1 cut(s) 9
TfiI GAWTC 1 cut(s) 707
Tru1I TTAA 2 cut(s) 65, 689
Tru9I TTAA 2 cut(s) 65, 689
TscAI CASTG 2 cut(s) 36, 316
TseI GCWGC 1 cut(s) 206
TspDTI ATGAA 1 cut(s) 65
TspRI CASTG 2 cut(s) 36, 316
VpaK11BI GGWCC 1 cut(s) 729
XmiI GTMKAC 1 cut(s) 465
XspI CTAG 1 cut(s) 784
Zsp2I ATGCAT 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.