Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013139.1

Orthogroup ID

OG0004692

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 333

Gene Structure 333 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013139.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

atggttgaaagagatggttctgcaaagggaattgtttttagccagttcacatcattcttggatctcattcactactccttgcaaaagtcgggtgtcaactgtgttcagttggttggaagcatgaccatgtctgcgagggatactgctataaagagattcactaaggatccagattgcagaattttcttaatgagcttgaaagccggaggtgttgctcttaatcttacagtcgcatcacat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000109 GO:0000166 GO:0000720 GO:0003674 GO:0003676 GO:0003677 GO:0003678 GO:0003824 GO:0004003 GO:0004386 GO:0004842 GO:0005488 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006259 GO:0006281 GO:0006289 GO:0006290 GO:0006464 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0006996 GO:0008026 GO:0008094 GO:0008144 GO:0008150 GO:0008152 GO:0008270 GO:0009987 GO:0016043 GO:0016462 GO:0016567 GO:0016740 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017076 GO:0017111 GO:0019538 GO:0019787 GO:0030554 GO:0032392 GO:0032446 GO:0032508 GO:0032553 GO:0032555 GO:0032559 GO:0032991 GO:0033554 GO:0034641 GO:0035639 GO:0036094 GO:0036211 GO:0042623 GO:0043167 GO:0043168 GO:0043169 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0046483 GO:0046872 GO:0046914 GO:0050896 GO:0051276 GO:0051716 GO:0061630 GO:0061659 GO:0070035 GO:0070647 GO:0071103 GO:0071704 GO:0071840 GO:0090304 GO:0097159 GO:0097367 GO:0140096 GO:0140097 GO:1901265 GO:1901360 GO:1901363 GO:1901564 GO:1990391

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Helicase_C SNF2_N zf-C3HC4 zf-C3HC4_2 zf-C3HC4_3 zf-RING_UBOX

Protein Analysis

80

Amino Acids

8.71

Weight (kDa)

9.18

Isoelectric Point (pI)

28.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004692)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G02670 AT1G02670 AT1G02670 AT1G02670 AT1G02670 AT1G02670 AT1G02670 AT1G05120 AT1G05120
fragaria_vesca	FvH4_6g42970 FvH4_6g42970
malus_domestica	MD17G1098500.v1.1
prunus_persica	Prupe.3G215900_v2.0.a1 Prupe.3G215900_v2.0.a1
pyrus_communis	pycom09g03310 pycom17g09390
rosa_chinensis	RchiOBHm_Chr2g0158951
rosa_laevigata	RLG00000021126
rosa_multiflora	Rmu_sc0002845.1_g000016 Rmu_sc0007967.1_g000006 Rmu_sc0013139.1_g000001 Rmu_sc0030100.1_g000001
rosa_roxburghii	Rroxscaffold_1G00030500 Rroxscaffold_2G00090850
rosa_rugosa	Rorug02G0473200
rosa_samantha	Rh2AG539700 Rh2BG552600 Rh2CG523000 Rh2DG562300
rosa_wichuraiana	Rw2G044670 Rw7G039330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	69, 161, 174
AcsI	RAATTY	1 cut(s)	180
AgsI	TTSAA	2 cut(s)	8, 199
AluBI	AGCT	1 cut(s)	195
AluI	AGCT	1 cut(s)	195
AlwI	GGATC	3 cut(s)	69, 161, 174
ApoI	RAATTY	1 cut(s)	180
BamHI	GGATCC	1 cut(s)	166
BccI	CCATC	1 cut(s)	8
BciVI	GTATCC	1 cut(s)	133
BfuI	GTATCC	1 cut(s)	133
BmiI	GGNNCC	1 cut(s)	168
Bse1I	ACTGG	1 cut(s)	43
BseNI	ACTGG	1 cut(s)	43
BsiSI	CCGG	1 cut(s)	204
Bsp143I	GATC	2 cut(s)	61, 166
BspLI	GGNNCC	1 cut(s)	168
BspPI	GGATC	3 cut(s)	69, 161, 174
BsrI	ACTGG	1 cut(s)	43
BssMI	GATC	2 cut(s)	61, 166
Bst4CI	ACNGT	2 cut(s)	101, 229
BstDEI	CTNAG	1 cut(s)	162
BstKTI	GATC	2 cut(s)	64, 169
BstMBI	GATC	2 cut(s)	61, 166
BstX2I	RGATCY	2 cut(s)	61, 166
BstYI	RGATCY	2 cut(s)	61, 166
BsuI	GTATCC	1 cut(s)	133
CviAII	CATG	2 cut(s)	121, 127
CviJI	RGCY	3 cut(s)	42, 195, 203
CviKI_1	RGCY	3 cut(s)	42, 195, 203
DdeI	CTNAG	1 cut(s)	162
DpnI	GATC	2 cut(s)	63, 168
DpnII	GATC	2 cut(s)	61, 166
FaeI	CATG	2 cut(s)	124, 130
FaiI	YATR	3 cut(s)	122, 128, 149
FatI	CATG	2 cut(s)	120, 126
HapII	CCGG	1 cut(s)	204
Hin1II	CATG	2 cut(s)	124, 130
HincII	GTYRAC	1 cut(s)	97
HindII	GTYRAC	1 cut(s)	97
HinfI	GANTC	1 cut(s)	156
HpaII	CCGG	1 cut(s)	204
Hpy166II	GTNNAC	2 cut(s)	48, 97
Hpy188III	TCNNGA	1 cut(s)	170
Hpy8I	GTNNAC	2 cut(s)	48, 97
HpyCH4III	ACNGT	2 cut(s)	101, 229
HpyCH4V	TGCA	3 cut(s)	23, 82, 177
HpyF3I	CTNAG	1 cut(s)	162
Hsp92II	CATG	2 cut(s)	124, 130
Kzo9I	GATC	2 cut(s)	61, 166
LpnPI	CCDG	3 cut(s)	56, 183, 217
MalI	GATC	2 cut(s)	63, 168
MboI	GATC	2 cut(s)	61, 166
MflI	RGATCY	2 cut(s)	61, 166
MluCI	AATT	2 cut(s)	30, 180
MmeI	TCCRAC	1 cut(s)	94
MnlI	CCTC	2 cut(s)	129, 200
MseI	TTAA	2 cut(s)	188, 219
MslI	CAYNNNNRTG	1 cut(s)	125
MspI	CCGG	1 cut(s)	204
NdeII	GATC	2 cut(s)	61, 166
NlaIII	CATG	2 cut(s)	124, 130
NlaIV	GGNNCC	1 cut(s)	168
PfeI	GAWTC	1 cut(s)	156
PflFI	GACNNNGTC	1 cut(s)	127
PspN4I	GGNNCC	1 cut(s)	168
PsuI	RGATCY	2 cut(s)	61, 166
PsyI	GACNNNGTC	1 cut(s)	127
RseI	CAYNNNNRTG	1 cut(s)	125
SaqAI	TTAA	2 cut(s)	188, 219
Sau3AI	GATC	2 cut(s)	61, 166
SetI	ASST	2 cut(s)	197, 211
SmiMI	CAYNNNNRTG	1 cut(s)	125
Sse9I	AATT	2 cut(s)	30, 180
TaaI	ACNGT	2 cut(s)	101, 229
TasI	AATT	2 cut(s)	30, 180
TfiI	GAWTC	1 cut(s)	156
Tru1I	TTAA	2 cut(s)	188, 219
Tru9I	TTAA	2 cut(s)	188, 219
Tth111I	GACNNNGTC	1 cut(s)	127
XapI	RAATTY	1 cut(s)	180

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.