Rmu_sc0014584.1_g000010

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014584.1
OG0012646
Physical Location & Seq
Reverse (-)
24624 .. 25250
627 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014584.1_g000010.1.cds

Sequence Viewer

Length: 627 bp
atgttgatgatgaaggcgaggccgatcaagaaagaaagccgattgggagaaagagaaaacttagatatgttaaccaaggctctgtgcatcatgggggaatggtattcggaagagtacacaagccttgttgatgagagtgcaattttgcttcttcgaaaaaacgagcagtacaaagcactagcttcatcaatatcgtcaggaattccaagggaaaagaagaggaaacatagagagattgatcgattggaggagaagaagcctagaaagaaaaaagcttccagacaactagtaatgcagaactcagatttacttgataggcaaagccaaactgctaccagtcccacagtgcctattcaacaacaaaaacctgacagtggtggtgatgataattttgtgttcttcaaggatattgatattggaatatgggagtttccttctctggatgattttgtcatggcttgtcctccttcacttacggaatgtgatcaagaagcattagcaacccttgagtttccttctcttgatgattttgtcatggcttgttctcctctacttatggattgtgatcaagaagcattagcaacccttgagtttccaaaatatacttatcaaacccctaatatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

208

Amino Acids

23.84

Weight (kDa)

4.96

Isoelectric Point (pI)

50.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 201
AfaI GTAC 2 cut(s) 116, 170
AfiI CCNNNNNNNGG 1 cut(s) 374
AgsI TTSAA 2 cut(s) 356, 403
AhlI ACTAGT 1 cut(s) 286
AluBI AGCT 2 cut(s) 182, 275
AluI AGCT 2 cut(s) 182, 275
AoxI GGCC 1 cut(s) 20
ApoI RAATTY 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 392
AsuII TTCGAA 1 cut(s) 154
BclI TGATCA 2 cut(s) 484, 565
BcuI ACTAGT 1 cut(s) 286
BfaI CTAG 3 cut(s) 179, 261, 287
BmsI GCATC 1 cut(s) 96
Bpu14I TTCGAA 1 cut(s) 154
BpuEI CTTGAG 2 cut(s) 527, 608
Bsa29I ATCGAT 1 cut(s) 241
BsaBI GATNNNNATC 1 cut(s) 564
BsaJI CCNNGG 2 cut(s) 75, 206
Bsc4I CCNNNNNNNGG 1 cut(s) 374
Bse1I ACTGG 1 cut(s) 336
Bse8I GATNNNNATC 1 cut(s) 564
BseCI ATCGAT 1 cut(s) 241
BseDI CCNNGG 2 cut(s) 75, 206
BseGI GGATG 1 cut(s) 448
BseJI GATNNNNATC 1 cut(s) 564
BseLI CCNNNNNNNGG 1 cut(s) 374
BseMII CTCAG 1 cut(s) 315
BseNI ACTGG 1 cut(s) 336
BseRI GAGGAG 2 cut(s) 263, 537
BshFI GGCC 1 cut(s) 22
BshVI ATCGAT 1 cut(s) 241
BslFI GGGAC 1 cut(s) 324
BslI CCNNNNNNNGG 1 cut(s) 374
BsmFI GGGAC 1 cut(s) 324
BsnI GGCC 1 cut(s) 22
Bsp119I TTCGAA 1 cut(s) 154
Bsp143I GATC 4 cut(s) 24, 238, 484, 565
BspANI GGCC 1 cut(s) 22
BspCNI CTCAG 1 cut(s) 314
BspDI ATCGAT 1 cut(s) 241
BspT104I TTCGAA 1 cut(s) 154
BsrI ACTGG 1 cut(s) 336
BssECI CCNNGG 2 cut(s) 75, 206
BssMI GATC 4 cut(s) 24, 238, 484, 565
BssT1I CCWWGG 2 cut(s) 75, 206
Bst4CI ACNGT 2 cut(s) 346, 374
Bst6I CTCTTC 2 cut(s) 105, 212
BstBI TTCGAA 1 cut(s) 154
BstDEI CTNAG 2 cut(s) 61, 301
BstF5I GGATG 1 cut(s) 448
BstKTI GATC 4 cut(s) 27, 241, 487, 568
BstMBI GATC 4 cut(s) 24, 238, 484, 565
Bsu15I ATCGAT 1 cut(s) 241
BsuRI GGCC 1 cut(s) 22
BsuTUI ATCGAT 1 cut(s) 241
BtsCI GGATG 1 cut(s) 448
BtsIMutI CAGTG 2 cut(s) 351, 379
ClaI ATCGAT 1 cut(s) 241
Csp6I GTAC 2 cut(s) 115, 169
CviAII CATG 3 cut(s) 91, 454, 535
CviQI GTAC 2 cut(s) 115, 169
DdeI CTNAG 2 cut(s) 61, 301
DpnI GATC 4 cut(s) 26, 240, 486, 567
DpnII GATC 4 cut(s) 24, 238, 484, 565
Eam1104I CTCTTC 2 cut(s) 105, 212
EarI CTCTTC 2 cut(s) 105, 212
Eco130I CCWWGG 2 cut(s) 75, 206
EcoRI GAATTC 1 cut(s) 201
EcoT14I CCWWGG 2 cut(s) 75, 206
ErhI CCWWGG 2 cut(s) 75, 206
FaeI CATG 3 cut(s) 94, 457, 538
FaqI GGGAC 1 cut(s) 324
FatI CATG 3 cut(s) 90, 453, 534
FbaI TGATCA 2 cut(s) 484, 565
FokI GGATG 1 cut(s) 455
FspBI CTAG 3 cut(s) 179, 261, 287
HaeIII GGCC 1 cut(s) 22
Hin1II CATG 3 cut(s) 94, 457, 538
HincII GTYRAC 1 cut(s) 72
HindII GTYRAC 1 cut(s) 72
HindIII AAGCTT 1 cut(s) 273
HpaI GTTAAC 1 cut(s) 72
HphI GGTGA 1 cut(s) 392
Hpy166II GTNNAC 2 cut(s) 72, 117
Hpy188I TCNGA 2 cut(s) 109, 304
Hpy188III TCNNGA 7 cut(s) 28, 198, 279, 440, 488, 521, 569
Hpy8I GTNNAC 2 cut(s) 72, 117
HpyAV CCTTC 4 cut(s) 7, 444, 477, 525
HpyCH4III ACNGT 2 cut(s) 346, 374
HpyCH4V TGCA 3 cut(s) 87, 140, 295
HpyF3I CTNAG 2 cut(s) 61, 301
Hsp92II CATG 3 cut(s) 94, 457, 538
Ksp22I TGATCA 2 cut(s) 484, 565
KspAI GTTAAC 1 cut(s) 72
Kzo9I GATC 4 cut(s) 24, 238, 484, 565
LpnPI CCDG 5 cut(s) 183, 292, 349, 381, 425
LweI GCATC 1 cut(s) 96
MaeI CTAG 3 cut(s) 179, 261, 287
MalI GATC 4 cut(s) 26, 240, 486, 567
MboI GATC 4 cut(s) 24, 238, 484, 565
MboII GAAGA 5 cut(s) 122, 143, 229, 265, 391
MluCI AATT 3 cut(s) 141, 201, 388
MnlI CCTC 5 cut(s) 12, 213, 241, 474, 558
MseI TTAA 1 cut(s) 71
NdeII GATC 4 cut(s) 24, 238, 484, 565
NlaIII CATG 3 cut(s) 94, 457, 538
NspV TTCGAA 1 cut(s) 154
RsaI GTAC 2 cut(s) 116, 170
RsaNI GTAC 2 cut(s) 115, 169
SaqAI TTAA 1 cut(s) 71
Sau3AI GATC 4 cut(s) 24, 238, 484, 565
SetI ASST 3 cut(s) 184, 277, 370
SfaNI GCATC 1 cut(s) 96
SfuI TTCGAA 1 cut(s) 154
SmlI CTYRAG 2 cut(s) 506, 587
SmoI CTYRAG 2 cut(s) 506, 587
SpeI ACTAGT 1 cut(s) 286
Sse9I AATT 3 cut(s) 141, 201, 388
SspMI CTAG 3 cut(s) 179, 261, 287
StyI CCWWGG 2 cut(s) 75, 206
TaaI ACNGT 2 cut(s) 346, 374
TaqI TCGA 2 cut(s) 154, 241
TasI AATT 3 cut(s) 141, 201, 388
TatI WGTACW 2 cut(s) 114, 168
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TscAI CASTG 2 cut(s) 351, 379
TspDTI ATGAA 2 cut(s) 26, 174
TspGWI ACGGA 1 cut(s) 491
TspRI CASTG 2 cut(s) 351, 379
XapI RAATTY 1 cut(s) 201
XspI CTAG 3 cut(s) 179, 261, 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.