Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0015095.1

Orthogroup ID

OG0011430

Physical Location & Seq

Genomic Coordinates Reverse (-)

9290 .. 11822

Gene Structure 2533 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0015095.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1116 bp

atggagcttccgctcatatcgctagccgctactgctagtacttccacggcgtcgtttggcagcaagctcgggctgtgcgattttccggtgacgagaaggaggcggacgggtttgttcgacggaggtagggtttctgtaaggcaggtcagggcttcggcggagcagaggagtagcgacggtattaatggaagtgaggcggagagtggaggacggcggttcaccagtcctgccatggaggtcaccacattgaatccgagcttcaacaacaaagctgagtatcctgtttgggagaagattggtgctgttgttagacttagttatggaattggtatatatggtgcaatggctttagcgggaagatttatatgctcaatgatgggtatcgatatcgtgggaggtttcgagttaaatttagatgcaattgtacaagggcttggatatgcagctccaccaatcatggcgcttctttttatactcgatgatgaagttgtaaagttatcacctcatgcacgtgcaattagagacgtagaggatgaggagctgcgcagtttcttttatggaatgtcaccgttgcagttcatactaattgttactgcaagctctttgggagaggaacttttctacagggctgctgttcagggatcattagctgagatatttttgaagggaacagatctggtgacagacattcgaggaatggcatctctgtctggggttctacccccatttgtcccatttgctcaggcatttgcagcagtgatcacagctgctcttacaggttctttgtactatgtggctgcctctccaaaagatcctgcctatgtagttgcaccagttttacaatctcgctctggtcgtgaagatctgaaaaagctgtttgcagcttggtatcagagaaggcaaatgaagaagatctactctccccttcttgaaggacttttggccctctatctcggttttgagtggaaccagacgaataatcttcttgcacctatgatcacccacggcatatattctgctgtgatattgggtcatggccttcggaagatacatgatcatcgtagacgactacatcagagaatcgagcagcttaaagaagaaagtagagtagaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Abi

Protein Analysis

371

Amino Acids

40.67

Weight (kDa)

8.74

Isoelectric Point (pI)

52.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011430)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G35260
fragaria_vesca	FvH4_5g21880
malus_domestica	MD00G1220600.v1.1 MD06G1033000.v1.1
prunus_persica	Prupe.5G038500_v2.0.a1
pyrus_communis	pycom06g02730
rosa_chinensis	RchiOBHm_Chr6g0284251 RchiOBHm_Chr7g0209431
rosa_laevigata	RLG00000003137
rosa_multiflora	Rmu_sc0001861.1_g000004 Rmu_sc0007059.1_g000001 Rmu_sc0015095.1_g000003
rosa_roxburghii	Rroxscaffold_3G00249470 Rroxscaffold_3G00250390
rosa_rugosa	Rorug07G0112500
rosa_samantha	Rh7AG246700 Rh7BG241700 Rh7CG262300 Rh7DG252900
rosa_wichuraiana	Rw7G020850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	545
Acc36I	ACCTGC	1 cut(s)	133
AccBSI	CCGCTC	1 cut(s)	13
AccI	GTMKAC	1 cut(s)	1063
AciI	CCGC	7 cut(s)	11, 27, 103, 158, 197, 214, 353
AclWI	GGATC	2 cut(s)	649, 806
AcsI	RAATTY	1 cut(s)	409
AcvI	CACGTG	1 cut(s)	512
AcyI	GRCGYC	1 cut(s)	50
AfaI	GTAC	3 cut(s)	40, 426, 788
AgsI	TTSAA	4 cut(s)	250, 262, 664, 932
Alw26I	GTCTC	1 cut(s)	516
AlwI	GGATC	2 cut(s)	649, 806
Ama87I	CYCGRG	1 cut(s)	68
AoxI	GGCC	2 cut(s)	942, 1036
ApeKI	GCWGC	9 cut(s)	60, 443, 541, 629, 752, 767, 797, 881, 1087
ApoI	RAATTY	1 cut(s)	409
AseI	ATTAAT	1 cut(s)	183
AspLEI	GCGC	2 cut(s)	463, 546
AspS9I	GGNCC	1 cut(s)	943
AsuHPI	GGTGA	7 cut(s)	100, 211, 232, 492, 558, 691, 991
AsuNHI	GCTAGC	1 cut(s)	22
AvaI	CYCGRG	1 cut(s)	68
BarI	GAAGNNNNNNTAC	2 cut(s)	899, 931
BbrPI	CACGTG	1 cut(s)	512
BbvI	GCAGC	9 cut(s)	72, 455, 528, 616, 754, 764, 784, 893, 1099
BccI	CCATC	1 cut(s)	370
BceAI	ACGGC	3 cut(s)	63, 227, 1021
BcgI	CGANNNNNNTGC	2 cut(s)	49, 83
BciVI	GTATCC	1 cut(s)	288
BclI	TGATCA	3 cut(s)	759, 996, 1054
BcoDI	GTCTC	1 cut(s)	516
BfaI	CTAG	2 cut(s)	23, 36
BfmI	CTRYAG	1 cut(s)	622
BfoI	RGCGCY	1 cut(s)	464
BfuAI	ACCTGC	1 cut(s)	133
BfuI	GTATCC	1 cut(s)	288
BglII	AGATCT	3 cut(s)	673, 862, 912
BmcAI	AGTACT	1 cut(s)	40
BmeT110I	CYCGRG	1 cut(s)	68
BmgT120I	GGNCC	1 cut(s)	943
BmiI	GGNNCC	1 cut(s)	968
BmsI	GCATC	2 cut(s)	406, 710
BmtI	GCTAGC	1 cut(s)	26
Bpu10I	CCTNAGC	1 cut(s)	741
Bsa29I	ATCGAT	1 cut(s)	384
BsaAI	YACGTR	1 cut(s)	512
BsaBI	GATNNNNATC	1 cut(s)	380
BsaHI	GRCGYC	1 cut(s)	50
BsaJI	CCNNGG	3 cut(s)	45, 231, 1003
BsaWI	WCCGGW	1 cut(s)	85
BsaXI	ACNNNNNCTCC	2 cut(s)	114, 144
Bse1I	ACTGG	2 cut(s)	222, 833
Bse3DI	GCAATG	1 cut(s)	348
Bse8I	GATNNNNATC	1 cut(s)	380
BseCI	ATCGAT	1 cut(s)	384
BseDI	CCNNGG	3 cut(s)	45, 231, 1003
BseGI	GGATG	1 cut(s)	538
BseJI	GATNNNNATC	1 cut(s)	380
BseMI	GCAATG	1 cut(s)	348
BseMII	CTCAG	3 cut(s)	264, 642, 755
BseNI	ACTGG	2 cut(s)	222, 833
BseRI	GAGGAG	2 cut(s)	181, 551
BseXI	GCAGC	9 cut(s)	72, 455, 528, 616, 754, 764, 784, 893, 1099
BshFI	GGCC	2 cut(s)	944, 1038
BshVI	ATCGAT	1 cut(s)	384
BsiHKCI	CYCGRG	1 cut(s)	68
BsiSI	CCGG	1 cut(s)	86
BslFI	GGGAC	1 cut(s)	716
BsmAI	GTCTC	1 cut(s)	516
BsmBI	CGTCTC	1 cut(s)	516
BsmFI	GGGAC	1 cut(s)	716
BsnI	GGCC	2 cut(s)	944, 1038
BsoBI	CYCGRG	1 cut(s)	68
Bsp1407I	TGTACA	1 cut(s)	424
Bsp143I	GATC	8 cut(s)	641, 673, 759, 811, 862, 912, 996, 1054
Bsp19I	CCATGG	1 cut(s)	231
BspACI	CCGC	7 cut(s)	11, 27, 103, 158, 197, 214, 353
BspANI	GGCC	2 cut(s)	944, 1038
BspCNI	CTCAG	3 cut(s)	265, 643, 754
BspDI	ATCGAT	1 cut(s)	384
BspLI	GGNNCC	1 cut(s)	968
BspMI	ACCTGC	1 cut(s)	133
BspOI	GCTAGC	1 cut(s)	26
BspPI	GGATC	2 cut(s)	649, 806
BsrBI	CCGCTC	1 cut(s)	13
BsrDI	GCAATG	1 cut(s)	348
BsrGI	TGTACA	1 cut(s)	424
BsrI	ACTGG	2 cut(s)	222, 833
BssECI	CCNNGG	3 cut(s)	45, 231, 1003
BssMI	GATC	8 cut(s)	641, 673, 759, 811, 862, 912, 996, 1054
BssNI	GRCGYC	1 cut(s)	50
BssT1I	CCWWGG	1 cut(s)	231
Bst4CI	ACNGT	2 cut(s)	179, 570
BstACI	GRCGYC	1 cut(s)	50
BstAUI	TGTACA	1 cut(s)	424
BstBAI	YACGTR	1 cut(s)	512
BstC8I	GCNNGC	3 cut(s)	24, 65, 598
BstDEI	CTNAG	4 cut(s)	273, 314, 651, 741
BstDSI	CCRYGG	3 cut(s)	45, 231, 1003
BstEII	GGTNACC	1 cut(s)	238
BstF5I	GGATG	1 cut(s)	538
BstH2I	RGCGCY	1 cut(s)	464
BstHHI	GCGC	2 cut(s)	463, 546
BstKTI	GATC	8 cut(s)	644, 676, 762, 814, 865, 915, 999, 1057
BstMAI	GTCTC	1 cut(s)	516
BstMBI	GATC	8 cut(s)	641, 673, 759, 811, 862, 912, 996, 1054
BstMWI	GCNNNNNNNGC	3 cut(s)	19, 32, 752
BstPI	GGTNACC	1 cut(s)	238
BstSFI	CTRYAG	1 cut(s)	622
BstV1I	GCAGC	9 cut(s)	72, 455, 528, 616, 754, 764, 784, 893, 1099
BstX2I	RGATCY	4 cut(s)	673, 811, 862, 912
BstYI	RGATCY	4 cut(s)	673, 811, 862, 912
Bsu15I	ATCGAT	1 cut(s)	384
BsuI	GTATCC	1 cut(s)	288
BsuRI	GGCC	2 cut(s)	944, 1038
BsuTUI	ATCGAT	1 cut(s)	384
BtgI	CCRYGG	3 cut(s)	45, 231, 1003
BtsCI	GGATG	1 cut(s)	538
BtsI	GCAGTG	1 cut(s)	762
BtsIMutI	CAGTG	1 cut(s)	762
BveI	ACCTGC	1 cut(s)	133
Cac8I	GCNNGC	3 cut(s)	24, 65, 598
CfoI	GCGC	2 cut(s)	463, 546
Cfr13I	GGNCC	1 cut(s)	943
ClaI	ATCGAT	1 cut(s)	384
CseI	GACGC	1 cut(s)	39
Csp6I	GTAC	3 cut(s)	39, 425, 787
CviAII	CATG	5 cut(s)	232, 457, 506, 1034, 1052
CviQI	GTAC	3 cut(s)	39, 425, 787
DdeI	CTNAG	4 cut(s)	273, 314, 651, 741
DpnI	GATC	8 cut(s)	643, 675, 761, 813, 864, 914, 998, 1056
DpnII	GATC	8 cut(s)	641, 673, 759, 811, 862, 912, 996, 1054
EciI	GGCGGA	3 cut(s)	118, 173, 212
Eco130I	CCWWGG	1 cut(s)	231
Eco32I	GATATC	1 cut(s)	388
Eco72I	CACGTG	1 cut(s)	512
Eco88I	CYCGRG	1 cut(s)	68
Eco91I	GGTNACC	1 cut(s)	238
EcoO65I	GGTNACC	1 cut(s)	238
EcoRV	GATATC	1 cut(s)	388
EcoT14I	CCWWGG	1 cut(s)	231
ErhI	CCWWGG	1 cut(s)	231
Esp3I	CGTCTC	1 cut(s)	516
FaeI	CATG	5 cut(s)	235, 460, 509, 1037, 1055
FaqI	GGGAC	1 cut(s)	716
FatI	CATG	5 cut(s)	231, 456, 505, 1033, 1051
FauI	CCCGC	1 cut(s)	346
FbaI	TGATCA	3 cut(s)	759, 996, 1054
FblI	GTMKAC	1 cut(s)	1063
FokI	GGATG	1 cut(s)	545
FspBI	CTAG	2 cut(s)	23, 36
FspI	TGCGCA	1 cut(s)	545
GlaI	GCGC	2 cut(s)	462, 545
HaeII	RGCGCY	1 cut(s)	464
HaeIII	GGCC	2 cut(s)	944, 1038
HapII	CCGG	1 cut(s)	86
HgaI	GACGC	1 cut(s)	39
HhaI	GCGC	2 cut(s)	463, 546
Hin1I	GRCGYC	1 cut(s)	50
Hin1II	CATG	5 cut(s)	235, 460, 509, 1037, 1055
Hin6I	GCGC	2 cut(s)	461, 544
HinP1I	GCGC	2 cut(s)	461, 544
HinfI	GANTC	2 cut(s)	250, 1080
HpaII	CCGG	1 cut(s)	86
HphI	GGTGA	7 cut(s)	100, 211, 232, 492, 558, 691, 991
Hpy166II	GTNNAC	2 cut(s)	219, 1064
Hpy188I	TCNGA	5 cut(s)	255, 867, 894, 1044, 1077
Hpy188III	TCNNGA	2 cut(s)	857, 929
Hpy8I	GTNNAC	2 cut(s)	219, 1064
Hpy99I	CGWCG	3 cut(s)	55, 122, 179
HpyAV	CCTTC	6 cut(s)	90, 658, 891, 926, 935, 1049
HpyCH4III	ACNGT	2 cut(s)	179, 570
HpyCH4IV	ACGT	2 cut(s)	511, 525
HpyF10VI	GCNNNNNNNGC	3 cut(s)	19, 32, 752
HpyF3I	CTNAG	4 cut(s)	273, 314, 651, 741
HpySE526I	ACGT	2 cut(s)	511, 525
Hsp92I	GRCGYC	1 cut(s)	50
Hsp92II	CATG	5 cut(s)	235, 460, 509, 1037, 1055
HspAI	GCGC	2 cut(s)	461, 544
Ksp22I	TGATCA	3 cut(s)	759, 996, 1054
Kzo9I	GATC	8 cut(s)	641, 673, 759, 811, 862, 912, 996, 1054
LmnI	GCTCC	4 cut(s)	4, 160, 451, 538
Lsp1109I	GCAGC	9 cut(s)	72, 455, 528, 616, 754, 764, 784, 893, 1099
LweI	GCATC	2 cut(s)	406, 710
MaeI	CTAG	2 cut(s)	23, 36
MaeII	ACGT	2 cut(s)	511, 525
MaeIII	GTNAC	5 cut(s)	88, 238, 564, 589, 679
MalI	GATC	8 cut(s)	643, 675, 761, 813, 864, 914, 998, 1056
MbiI	CCGCTC	1 cut(s)	13
MboI	GATC	8 cut(s)	641, 673, 759, 811, 862, 912, 996, 1054
MboII	GAAGA	8 cut(s)	304, 369, 872, 919, 922, 974, 1057, 1109
MfeI	CAATTG	1 cut(s)	420
MflI	RGATCY	4 cut(s)	673, 811, 862, 912
MluCI	AATT	5 cut(s)	324, 409, 420, 516, 585
MseI	TTAA	3 cut(s)	183, 407, 1092
MslI	CAYNNNNRTG	1 cut(s)	510
MspA1I	CMGCKG	1 cut(s)	767
MspI	CCGG	1 cut(s)	86
MunI	CAATTG	1 cut(s)	420
MwoI	GCNNNNNNNGC	3 cut(s)	19, 32, 752
NcoI	CCATGG	1 cut(s)	231
NdeII	GATC	8 cut(s)	641, 673, 759, 811, 862, 912, 996, 1054
NheI	GCTAGC	1 cut(s)	22
NlaIII	CATG	5 cut(s)	235, 460, 509, 1037, 1055
NlaIV	GGNNCC	1 cut(s)	968
NmuCI	GTSAC	4 cut(s)	88, 238, 564, 679
NsbI	TGCGCA	1 cut(s)	545
PcsI	WCGNNNNNNNCGW	2 cut(s)	75, 853
PfeI	GAWTC	2 cut(s)	250, 1080
PmaCI	CACGTG	1 cut(s)	512
PmlI	CACGTG	1 cut(s)	512
Ppu21I	YACGTR	1 cut(s)	512
PshBI	ATTAAT	1 cut(s)	183
PspCI	CACGTG	1 cut(s)	512
PspEI	GGTNACC	1 cut(s)	238
PspN4I	GGNNCC	1 cut(s)	968
PspPI	GGNCC	1 cut(s)	943
PsuI	RGATCY	4 cut(s)	673, 811, 862, 912
PvuII	CAGCTG	1 cut(s)	767
RsaI	GTAC	3 cut(s)	40, 426, 788
RsaNI	GTAC	3 cut(s)	39, 425, 787
RseI	CAYNNNNRTG	1 cut(s)	510
SaqAI	TTAA	3 cut(s)	183, 407, 1092
Sau3AI	GATC	8 cut(s)	641, 673, 759, 811, 862, 912, 996, 1054
Sau96I	GGNCC	1 cut(s)	943
ScaI	AGTACT	1 cut(s)	40
SfaNI	GCATC	2 cut(s)	406, 710
SfcI	CTRYAG	1 cut(s)	622
SmiMI	CAYNNNNRTG	1 cut(s)	510
Sse9I	AATT	5 cut(s)	324, 409, 420, 516, 585
SsiI	CCGC	7 cut(s)	11, 27, 103, 158, 197, 214, 353
SspMI	CTAG	2 cut(s)	23, 36
StyI	CCWWGG	1 cut(s)	231
TaaI	ACNGT	2 cut(s)	179, 570
TaiI	ACGT	2 cut(s)	514, 528
TaqI	TCGA	6 cut(s)	117, 384, 402, 477, 691, 1083
TasI	AATT	5 cut(s)	324, 409, 420, 516, 585
TatI	WGTACW	3 cut(s)	38, 424, 786
TauI	GCSGC	1 cut(s)	29
TfiI	GAWTC	2 cut(s)	250, 1080
Tru1I	TTAA	3 cut(s)	183, 407, 1092
Tru9I	TTAA	3 cut(s)	183, 407, 1092
TscAI	CASTG	1 cut(s)	762
TseFI	GTSAC	4 cut(s)	88, 238, 564, 679
TseI	GCWGC	9 cut(s)	60, 443, 541, 629, 752, 767, 797, 881, 1087
Tsp45I	GTSAC	4 cut(s)	88, 238, 564, 679
TspDTI	ATGAA	3 cut(s)	498, 568, 920
TspGWI	ACGGA	1 cut(s)	135
TspRI	CASTG	1 cut(s)	762
VspI	ATTAAT	1 cut(s)	183
XapI	RAATTY	1 cut(s)	409
XcmI	CCANNNNNNNNNTGG	1 cut(s)	229
XmiI	GTMKAC	1 cut(s)	1063
XspI	CTAG	2 cut(s)	23, 36
ZrmI	AGTACT	1 cut(s)	40

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.