Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017529.1

Orthogroup ID

OG0005793

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 2471

Gene Structure 2471 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017529.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 516 bp

ttggaagaagccaagaaaacaaggggtgaacgagtagatgatggaactgcccacagggatagaccactttacgaggttctgaaagaaaacaaggagaggaaggatgcagagttcaacgaacgtttcaagcacagaccacctaaagctttggacgatgaggagactgactttcttgatagaatgcagaaggcaagaaaggaatacgaacggcgactagaggatgaggaagcacaacagcttctgagagtccagggacagttatctgcagctgaaaagaagaagaatcctactcctggtttattgggtatgattatcaaagtgaaggagccacaagcaaagaaacctaaaattgaagacgctaacaacacagtgaaaactcctcatgttgatagtaaagatcatagtttagaggtagtgaagactcccaatgatgataatactgatcatttcagtgttgttgctaagactgctcttgtttcatatagtgatactgatgatgatagtgaagatgactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Nefa_Nip30_N

Protein Analysis

171

Amino Acids

19.71

Weight (kDa)

5.29

Isoelectric Point (pI)

24.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005793)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G62140
fragaria_vesca	FvH4_1g26260 FvH4_1g26260 FvH4_1g26260 FvH4_1g26260
malus_domestica	MD17G1284800.v1.1
prunus_persica	Prupe.3G003000_v2.0.a1 Prupe.3G003000_v2.0.a1
pyrus_communis	pycom17g28060
rosa_chinensis	RchiOBHm_Chr3g0485921
rosa_laevigata	RLG00000023122
rosa_multiflora	Rmu_sc0004876.1_g000003 Rmu_sc0008757.1_g000021 Rmu_sc0017529.1_g000001
rosa_roxburghii	Rroxscaffold_4G00297600 Rroxscaffold_6G00396200
rosa_rugosa	Rorug01G0265400 Rorug03G0222500 Rorug03G0222600
rosa_samantha	Rh1CG263400 Rh1DG274400 Rh3AG271800 Rh3BG306900 Rh3CG305500 Rh3DG301500
rosa_wichuraiana	Rw0G015520 Rw1G024840 Rw3G024150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	121
AfiI	CCNNNNNNNGG	1 cut(s)	293
AgsI	TTSAA	3 cut(s)	115, 127, 353
AjnI	CCWGG	2 cut(s)	249, 292
AloI	GAACNNNNNNTCC	2 cut(s)	95, 127
AluBI	AGCT	3 cut(s)	146, 238, 269
AluI	AGCT	3 cut(s)	146, 238, 269
Alw26I	GTCTC	1 cut(s)	155
AlwNI	CAGNNNCTG	1 cut(s)	241
ApeKI	GCWGC	1 cut(s)	266
AsuHPI	GGTGA	1 cut(s)	38
BbsI	GAAGAC	2 cut(s)	360, 425
BbvI	GCAGC	1 cut(s)	278
BccI	CCATC	1 cut(s)	35
BceAI	ACGGC	1 cut(s)	224
BciT130I	CCWGG	2 cut(s)	251, 294
BclI	TGATCA	1 cut(s)	442
BcoDI	GTCTC	1 cut(s)	155
BfaI	CTAG	2 cut(s)	215, 514
BfmI	CTRYAG	1 cut(s)	264
BisI	GCNGC	1 cut(s)	267
BlsI	GCNGC	1 cut(s)	268
Bme1390I	CCNGG	2 cut(s)	251, 294
BmiI	GGNNCC	1 cut(s)	327
BmrFI	CCNGG	2 cut(s)	251, 294
BmsI	GCATC	1 cut(s)	94
BpiI	GAAGAC	2 cut(s)	360, 425
BsaJI	CCNNGG	1 cut(s)	250
Bsc4I	CCNNNNNNNGG	1 cut(s)	293
BseBI	CCWGG	2 cut(s)	251, 294
BseDI	CCNNGG	1 cut(s)	250
BseGI	GGATG	2 cut(s)	109, 226
BseLI	CCNNNNNNNGG	1 cut(s)	293
BseMII	CTCAG	1 cut(s)	233
BseRI	GAGGAG	2 cut(s)	173, 369
BseXI	GCAGC	1 cut(s)	278
BslFI	GGGAC	1 cut(s)	267
BslI	CCNNNNNNNGG	1 cut(s)	293
BsmAI	GTCTC	1 cut(s)	155
BsmFI	GGGAC	1 cut(s)	267
BsmI	GAATGC	1 cut(s)	186
Bsp143I	GATC	2 cut(s)	397, 442
BspCNI	CTCAG	1 cut(s)	234
BspLI	GGNNCC	1 cut(s)	327
BspMAI	CTGCAG	1 cut(s)	268
BssECI	CCNNGG	1 cut(s)	250
BssMI	GATC	2 cut(s)	397, 442
Bst2UI	CCWGG	2 cut(s)	251, 294
Bst4CI	ACNGT	2 cut(s)	258, 370
BstDEI	CTNAG	2 cut(s)	242, 462
BstF5I	GGATG	2 cut(s)	109, 226
BstKTI	GATC	2 cut(s)	400, 445
BstMAI	GTCTC	1 cut(s)	155
BstMBI	GATC	2 cut(s)	397, 442
BstMWI	GCNNNNNNNGC	1 cut(s)	467
BstNI	CCWGG	2 cut(s)	251, 294
BstSCI	CCNGG	2 cut(s)	249, 292
BstSFI	CTRYAG	1 cut(s)	264
BstV1I	GCAGC	1 cut(s)	278
BstV2I	GAAGAC	2 cut(s)	360, 425
BtsCI	GGATG	2 cut(s)	109, 226
BtsIMutI	CAGTG	2 cut(s)	375, 457
CaiI	CAGNNNCTG	1 cut(s)	241
CseI	GACGC	1 cut(s)	365
CviAII	CATG	1 cut(s)	383
CviJI	RGCY	5 cut(s)	11, 146, 238, 269, 328
CviKI_1	RGCY	5 cut(s)	11, 146, 238, 269, 328
DdeI	CTNAG	2 cut(s)	242, 462
DpnI	GATC	2 cut(s)	399, 444
DpnII	GATC	2 cut(s)	397, 442
EcoRII	CCWGG	2 cut(s)	249, 292
FaeI	CATG	1 cut(s)	386
FaiI	YATR	5 cut(s)	308, 384, 402, 481, 483
FaqI	GGGAC	1 cut(s)	267
FatI	CATG	1 cut(s)	382
FbaI	TGATCA	1 cut(s)	442
Fnu4HI	GCNGC	1 cut(s)	267
FokI	GGATG	2 cut(s)	116, 233
Fsp4HI	GCNGC	1 cut(s)	267
FspBI	CTAG	2 cut(s)	215, 514
GluI	GCNGC	1 cut(s)	267
HgaI	GACGC	1 cut(s)	365
Hin1II	CATG	1 cut(s)	386
HindIII	AAGCTT	1 cut(s)	144
HinfI	GANTC	3 cut(s)	246, 283, 421
HphI	GGTGA	1 cut(s)	38
Hpy166II	GTNNAC	1 cut(s)	29
Hpy188I	TCNGA	2 cut(s)	81, 243
Hpy188III	TCNNGA	1 cut(s)	173
Hpy8I	GTNNAC	1 cut(s)	29
HpyAV	CCTTC	3 cut(s)	94, 181, 316
HpyCH4III	ACNGT	2 cut(s)	258, 370
HpyCH4IV	ACGT	1 cut(s)	121
HpyCH4V	TGCA	3 cut(s)	107, 184, 266
HpyF10VI	GCNNNNNNNGC	1 cut(s)	467
HpyF3I	CTNAG	2 cut(s)	242, 462
HpySE526I	ACGT	1 cut(s)	121
Hsp92II	CATG	1 cut(s)	386
Ksp22I	TGATCA	1 cut(s)	442
Kzo9I	GATC	2 cut(s)	397, 442
LmnI	GCTCC	1 cut(s)	325
LpnPI	CCDG	5 cut(s)	40, 236, 263, 279, 306
Lsp1109I	GCAGC	1 cut(s)	278
LweI	GCATC	1 cut(s)	94
MaeI	CTAG	2 cut(s)	215, 514
MaeII	ACGT	1 cut(s)	121
MalI	GATC	2 cut(s)	399, 444
MboI	GATC	2 cut(s)	397, 442
MboII	GAAGA	5 cut(s)	17, 289, 292, 365, 430
MluCI	AATT	1 cut(s)	348
MlyI	GAGTC	2 cut(s)	255, 415
MnlI	CCTC	7 cut(s)	67, 90, 151, 211, 217, 390, 403
MslI	CAYNNNNRTG	1 cut(s)	450
MspA1I	CMGCKG	1 cut(s)	269
MspR9I	CCNGG	2 cut(s)	251, 294
Mva1269I	GAATGC	1 cut(s)	186
MvaI	CCWGG	2 cut(s)	251, 294
MwoI	GCNNNNNNNGC	1 cut(s)	467
NdeII	GATC	2 cut(s)	397, 442
NlaIII	CATG	1 cut(s)	386
NlaIV	GGNNCC	1 cut(s)	327
PctI	GAATGC	1 cut(s)	186
PfeI	GAWTC	1 cut(s)	283
PkrI	GCNGC	1 cut(s)	268
PleI	GAGTC	2 cut(s)	254, 415
PpsI	GAGTC	2 cut(s)	254, 415
Psp1406I	AACGTT	1 cut(s)	121
Psp6I	CCWGG	2 cut(s)	249, 292
PspGI	CCWGG	2 cut(s)	249, 292
PspN4I	GGNNCC	1 cut(s)	327
PstI	CTGCAG	1 cut(s)	268
PstNI	CAGNNNCTG	1 cut(s)	241
PvuII	CAGCTG	1 cut(s)	269
RseI	CAYNNNNRTG	1 cut(s)	450
SatI	GCNGC	1 cut(s)	267
Sau3AI	GATC	2 cut(s)	397, 442
SchI	GAGTC	2 cut(s)	255, 415
ScrFI	CCNGG	2 cut(s)	251, 294
SetI	ASST	8 cut(s)	78, 124, 142, 148, 240, 271, 346, 414
SfaNI	GCATC	1 cut(s)	94
SfcI	CTRYAG	1 cut(s)	264
SmiMI	CAYNNNNRTG	1 cut(s)	450
Sse9I	AATT	1 cut(s)	348
SspMI	CTAG	2 cut(s)	215, 514
StyD4I	CCNGG	2 cut(s)	249, 292
TaaI	ACNGT	2 cut(s)	258, 370
TaiI	ACGT	1 cut(s)	124
TasI	AATT	1 cut(s)	348
TfiI	GAWTC	1 cut(s)	283
TscAI	CASTG	2 cut(s)	375, 457
TseI	GCWGC	1 cut(s)	266
TspDTI	ATGAA	1 cut(s)	468
TspRI	CASTG	2 cut(s)	375, 457
XspI	CTAG	2 cut(s)	215, 514

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.