Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0018598.1

Orthogroup ID

OG0007978

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1630

Gene Structure 1630 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0018598.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1209 bp

atgtcacacctctgtgattttcaaatccacattaatggtctgcaaatattctttgtgaatgaggaggttttatcaacatatgcagggaggttgaagaagattatcaagcaagaaaggagaagatcccagatcaagtactcggggattgaaatcgaagacttccctggaggccctgatgggtttgagttgatctcaaggttctgttacagcaatggaagaatcacaacaacagtttcaaatgtgtccctcctccattgctgtgcagtctttcttggtatgactgagaaagtctcaaccaacaatctcttgaaacaaacagaaacctttcttgagggactctttgactggtcatggaaagaaatactagtctgcctgaaaagctgtgagtcattcttgaactatgcagattcttgtggtcttgtagacaagctcatttgtgcagttttagcaaagattgctcagaattcagacataggcagcctcattgctacttcgtcttcgtcgtcttcatctccagaaactacatctgggttcagagtgtcttcctcatttaagaacacccctgagtcactcaagccaagttcatcaagtagagcttggtggtttgatgatgtgtccattttacccccaaagatcattgagaaactcatccaaagcttaggggcgtatggttctgaaaacaacagcttgatcctcacaaggtttctcctccattacctgaaaatttcagctcaaagaaagaaaggcaatactagtcacagatcatccgagtttagtgctcttgcagacacagctattcatgggattattttggtgggcaaaaaagtcttttcctgcagagccttgttttgggttttgaggattgtgtctggttttggaatcagtagagagtacagacttggtttggagagattgattggtgggatgctcgatgaagcaacattggatgacttgttagtatctgggcatgataggggtgtttatgatgtcaatcttgttataaggttgataagagtttttgctaaaagtgagggagtttctgtgcaaaagttgaggaaagctggtaggttgatcgataagtacctaggtgaaatatcacctgatcagaatctcaagatttctaaatttcttggagttgcagagagtttaccagattctgctagggagtgctttgatggggcctacagagccattgatatttatcttgag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BTB NPH3

Protein Analysis

403

Amino Acids

44.85

Weight (kDa)

8.43

Isoelectric Point (pI)

44.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007978)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G19850
fragaria_vesca	FvH4_4g36690 FvH4_4g36690
malus_domestica	MD13G1008200.v1.1
prunus_persica	Prupe.1G344900_v2.0.a1 Prupe.1G344900_v2.0.a1
pyrus_communis	pycom05g06860 pycom07g12620 pycom13g00670 pycom16g00540 pycom16g00550 pycom16g04040
rosa_chinensis	RchiOBHm_Chr4g0446401
rosa_laevigata	RLG00000005664
rosa_multiflora	Rmu_sc0008360.1_g000004 Rmu_sc0010778.1_g000006 Rmu_sc0018598.1_g000001
rosa_roxburghii	Rroxscaffold_5G00386840
rosa_rugosa	Rorug04G0371100
rosa_samantha	Rh4AG432600 Rh4BG441800 Rh4CG459100 Rh4DG440500
rosa_wichuraiana	Rw4G036950

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1001
AccI	GTMKAC	1 cut(s)	423
AclWI	GGATC	2 cut(s)	117, 685
AcsI	RAATTY	3 cut(s)	463, 723, 1124
AfaI	GTAC	3 cut(s)	137, 893, 1082
AfiI	CCNNNNNNNGG	1 cut(s)	849
AgsI	TTSAA	6 cut(s)	23, 94, 149, 237, 310, 397
AhlI	ACTAGT	2 cut(s)	364, 752
AjnI	CCWGG	1 cut(s)	163
AleI	CACNNNNGTG	1 cut(s)	12
AluBI	AGCT	8 cut(s)	381, 430, 596, 657, 687, 731, 794, 1061
AluI	AGCT	8 cut(s)	381, 430, 596, 657, 687, 731, 794, 1061
Alw21I	GWGCWC	1 cut(s)	781
Alw26I	GTCTC	1 cut(s)	295
AlwI	GGATC	2 cut(s)	117, 685
AlwNI	CAGNNNCTG	1 cut(s)	1157
Ama87I	CYCGRG	1 cut(s)	139
AoxI	GGCC	2 cut(s)	169, 1179
ApeKI	GCWGC	1 cut(s)	477
ApoI	RAATTY	3 cut(s)	463, 723, 1124
AseI	ATTAAT	1 cut(s)	33
Asp700I	GAANNNNTTC	1 cut(s)	324
AspA2I	CCTAGG	1 cut(s)	1084
AspS9I	GGNCC	2 cut(s)	170, 1179
AsuHPI	GGTGA	2 cut(s)	1089, 1100
AvaI	CYCGRG	1 cut(s)	139
AvrII	CCTAGG	1 cut(s)	1084
BbsI	GAAGAC	4 cut(s)	162, 489, 498, 534
Bbv12I	GWGCWC	1 cut(s)	781
BbvI	GCAGC	1 cut(s)	489
BccI	CCATC	2 cut(s)	170, 1169
BcgI	CGANNNNNNTGC	2 cut(s)	758, 792
BciT130I	CCWGG	1 cut(s)	165
BclI	TGATCA	1 cut(s)	1102
BcoDI	GTCTC	1 cut(s)	295
BcuI	ACTAGT	2 cut(s)	364, 752
BfaI	CTAG	4 cut(s)	365, 753, 1085, 1161
BfmI	CTRYAG	2 cut(s)	835, 1183
BisI	GCNGC	1 cut(s)	478
BlnI	CCTAGG	1 cut(s)	1084
BlsI	GCNGC	1 cut(s)	479
BmcAI	AGTACT	1 cut(s)	137
Bme1390I	CCNGG	1 cut(s)	165
BmeT110I	CYCGRG	1 cut(s)	139
BmgT120I	GGNCC	2 cut(s)	170, 1179
BmiI	GGNNCC	1 cut(s)	1180
BmrFI	CCNGG	1 cut(s)	165
BmsI	GCATC	1 cut(s)	915
BpiI	GAAGAC	4 cut(s)	162, 489, 498, 534
BplI	GAGNNNNNCTC	4 cut(s)	176, 208, 275, 307
BpmI	CTGGAG	2 cut(s)	186, 498
Bpu10I	CCTNAGC	1 cut(s)	658
BpuEI	CTTGAG	4 cut(s)	178, 350, 557, 1097
Bsa29I	ATCGAT	1 cut(s)	1074
BsaBI	GATNNNNATC	4 cut(s)	149, 990, 1107, 1200
BsaJI	CCNNGG	2 cut(s)	163, 1084
BsaXI	ACNNNNNCTCC	2 cut(s)	1026, 1056
Bsc4I	CCNNNNNNNGG	1 cut(s)	849
Bse1I	ACTGG	1 cut(s)	350
Bse3DI	GCAATG	3 cut(s)	217, 253, 483
Bse8I	GATNNNNATC	4 cut(s)	149, 990, 1107, 1200
BseBI	CCWGG	1 cut(s)	165
BseCI	ATCGAT	1 cut(s)	1074
BseDI	CCNNGG	2 cut(s)	163, 1084
BseGI	GGATG	4 cut(s)	648, 764, 930, 952
BseJI	GATNNNNATC	4 cut(s)	149, 990, 1107, 1200
BseLI	CCNNNNNNNGG	1 cut(s)	849
BseMI	GCAATG	3 cut(s)	217, 253, 483
BseMII	CTCAG	3 cut(s)	273, 473, 555
BseNI	ACTGG	1 cut(s)	350
BseRI	GAGGAG	3 cut(s)	77, 239, 698
BseXI	GCAGC	1 cut(s)	489
BsgI	GTGCAG	2 cut(s)	282, 459
BshFI	GGCC	2 cut(s)	171, 1181
BshVI	ATCGAT	1 cut(s)	1074
BsiHKAI	GWGCWC	1 cut(s)	781
BsiHKCI	CYCGRG	1 cut(s)	139
BslFI	GGGAC	2 cut(s)	229, 348
BslI	CCNNNNNNNGG	1 cut(s)	849
BsmAI	GTCTC	1 cut(s)	295
BsmFI	GGGAC	2 cut(s)	229, 348
BsnI	GGCC	2 cut(s)	171, 1181
BsoBI	CYCGRG	1 cut(s)	139
Bsp1286I	GDGCHC	1 cut(s)	781
Bsp143I	GATC	8 cut(s)	122, 129, 189, 633, 690, 761, 1071, 1102
BspANI	GGCC	2 cut(s)	171, 1181
BspCNI	CTCAG	3 cut(s)	274, 472, 556
BspDI	ATCGAT	1 cut(s)	1074
BspLI	GGNNCC	1 cut(s)	1180
BspMAI	CTGCAG	1 cut(s)	839
BspPI	GGATC	2 cut(s)	117, 685
BsrDI	GCAATG	3 cut(s)	217, 253, 483
BsrI	ACTGG	1 cut(s)	350
BssECI	CCNNGG	2 cut(s)	163, 1084
BssMI	GATC	8 cut(s)	122, 129, 189, 633, 690, 761, 1071, 1102
BssT1I	CCWWGG	1 cut(s)	1084
Bst2UI	CCWGG	1 cut(s)	165
Bst4CI	ACNGT	1 cut(s)	232
BstAPI	GCANNNNNTGC	1 cut(s)	455
BstDEI	CTNAG	4 cut(s)	282, 459, 564, 658
BstF5I	GGATG	4 cut(s)	648, 764, 930, 952
BstKTI	GATC	8 cut(s)	125, 132, 192, 636, 693, 764, 1074, 1105
BstMAI	GTCTC	1 cut(s)	295
BstMBI	GATC	8 cut(s)	122, 129, 189, 633, 690, 761, 1071, 1102
BstMWI	GCNNNNNNNGC	5 cut(s)	378, 446, 455, 791, 1187
BstNI	CCWGG	1 cut(s)	165
BstSCI	CCNGG	1 cut(s)	163
BstSFI	CTRYAG	2 cut(s)	835, 1183
BstV1I	GCAGC	1 cut(s)	489
BstV2I	GAAGAC	4 cut(s)	162, 489, 498, 534
BstX2I	RGATCY	1 cut(s)	122
BstXI	CCANNNNNNTGG	1 cut(s)	35
BstYI	RGATCY	1 cut(s)	122
Bsu15I	ATCGAT	1 cut(s)	1074
BsuRI	GGCC	2 cut(s)	171, 1181
BsuTUI	ATCGAT	1 cut(s)	1074
BtsCI	GGATG	4 cut(s)	648, 764, 930, 952
CaiI	CAGNNNCTG	1 cut(s)	1157
Cfr13I	GGNCC	2 cut(s)	170, 1179
ClaI	ATCGAT	1 cut(s)	1074
Csp6I	GTAC	3 cut(s)	136, 892, 1081
CviAII	CATG	3 cut(s)	351, 800, 968
CviQI	GTAC	3 cut(s)	136, 892, 1081
DdeI	CTNAG	4 cut(s)	282, 459, 564, 658
DpnI	GATC	8 cut(s)	124, 131, 191, 635, 692, 763, 1073, 1104
DpnII	GATC	8 cut(s)	122, 129, 189, 633, 690, 761, 1071, 1102
Eco130I	CCWWGG	1 cut(s)	1084
Eco88I	CYCGRG	1 cut(s)	139
EcoO109I	RGGNCCY	2 cut(s)	170, 1179
EcoRI	GAATTC	1 cut(s)	463
EcoRII	CCWGG	1 cut(s)	163
EcoT14I	CCWWGG	1 cut(s)	1084
ErhI	CCWWGG	1 cut(s)	1084
FaeI	CATG	3 cut(s)	354, 803, 971
FalI	AAGNNNNNCTT	2 cut(s)	580, 612
FaqI	GGGAC	2 cut(s)	229, 348
FatI	CATG	3 cut(s)	350, 799, 967
FauNDI	CATATG	1 cut(s)	79
FbaI	TGATCA	1 cut(s)	1102
FblI	GTMKAC	1 cut(s)	423
Fnu4HI	GCNGC	1 cut(s)	478
FokI	GGATG	4 cut(s)	635, 751, 937, 959
Fsp4HI	GCNGC	1 cut(s)	478
FspBI	CTAG	4 cut(s)	365, 753, 1085, 1161
GluI	GCNGC	1 cut(s)	478
GsuI	CTGGAG	2 cut(s)	186, 498
HaeIII	GGCC	2 cut(s)	171, 1181
Hin1II	CATG	3 cut(s)	354, 803, 971
HindIII	AAGCTT	1 cut(s)	655
HinfI	GANTC	8 cut(s)	219, 336, 386, 407, 566, 879, 1108, 1154
HphI	GGTGA	2 cut(s)	1089, 1100
Hpy166II	GTNNAC	2 cut(s)	424, 1148
Hpy188I	TCNGA	6 cut(s)	462, 469, 536, 676, 769, 1107
Hpy188III	TCNNGA	6 cut(s)	307, 329, 394, 515, 1114, 1205
Hpy8I	GTNNAC	2 cut(s)	424, 1148
Hpy99I	CGWCG	1 cut(s)	505
HpyCH4III	ACNGT	1 cut(s)	232
HpyCH4V	TGCA	9 cut(s)	43, 83, 263, 404, 440, 785, 837, 1045, 1139
HpyF10VI	GCNNNNNNNGC	5 cut(s)	378, 446, 455, 791, 1187
HpyF3I	CTNAG	4 cut(s)	282, 459, 564, 658
Hsp92II	CATG	3 cut(s)	354, 803, 971
Ksp22I	TGATCA	1 cut(s)	1102
Kzo9I	GATC	8 cut(s)	122, 129, 189, 633, 690, 761, 1071, 1102
Lsp1109I	GCAGC	1 cut(s)	489
LweI	GCATC	1 cut(s)	915
MaeI	CTAG	4 cut(s)	365, 753, 1085, 1161
MaeIII	GTNAC	4 cut(s)	3, 203, 567, 755
MalI	GATC	8 cut(s)	124, 131, 191, 635, 692, 763, 1073, 1104
MboI	GATC	8 cut(s)	122, 129, 189, 633, 690, 761, 1071, 1102
MboII	GAAGA	8 cut(s)	106, 109, 132, 167, 228, 489, 498, 534
MflI	RGATCY	1 cut(s)	122
MhlI	GDGCHC	1 cut(s)	781
MluCI	AATT	3 cut(s)	463, 723, 1124
MlyI	GAGTC	3 cut(s)	330, 395, 575
MroXI	GAANNNNTTC	1 cut(s)	324
MseI	TTAA	2 cut(s)	33, 552
MslI	CAYNNNNRTG	3 cut(s)	12, 33, 258
MspR9I	CCNGG	1 cut(s)	165
MvaI	CCWGG	1 cut(s)	165
MwoI	GCNNNNNNNGC	5 cut(s)	378, 446, 455, 791, 1187
NdeI	CATATG	1 cut(s)	79
NdeII	GATC	8 cut(s)	122, 129, 189, 633, 690, 761, 1071, 1102
NlaIII	CATG	3 cut(s)	354, 803, 971
NlaIV	GGNNCC	1 cut(s)	1180
NmuCI	GTSAC	3 cut(s)	3, 567, 755
OliI	CACNNNNGTG	1 cut(s)	12
PcsI	WCGNNNNNNNCGW	1 cut(s)	500
PdmI	GAANNNNTTC	1 cut(s)	324
PfeI	GAWTC	5 cut(s)	219, 407, 879, 1108, 1154
PkrI	GCNGC	1 cut(s)	479
PleI	GAGTC	3 cut(s)	330, 394, 574
PpsI	GAGTC	3 cut(s)	330, 394, 574
PshBI	ATTAAT	1 cut(s)	33
PsiI	TTATAA	1 cut(s)	1001
Psp6I	CCWGG	1 cut(s)	163
PspGI	CCWGG	1 cut(s)	163
PspN4I	GGNNCC	1 cut(s)	1180
PspPI	GGNCC	2 cut(s)	170, 1179
PstI	CTGCAG	1 cut(s)	839
PstNI	CAGNNNCTG	1 cut(s)	1157
PsuI	RGATCY	1 cut(s)	122
RsaI	GTAC	3 cut(s)	137, 893, 1082
RsaNI	GTAC	3 cut(s)	136, 892, 1081
RseI	CAYNNNNRTG	3 cut(s)	12, 33, 258
SaqAI	TTAA	2 cut(s)	33, 552
SatI	GCNGC	1 cut(s)	478
Sau3AI	GATC	8 cut(s)	122, 129, 189, 633, 690, 761, 1071, 1102
Sau96I	GGNCC	2 cut(s)	170, 1179
ScaI	AGTACT	1 cut(s)	137
SchI	GAGTC	3 cut(s)	330, 395, 575
ScrFI	CCNGG	1 cut(s)	165
SduI	GDGCHC	1 cut(s)	781
SfaNI	GCATC	1 cut(s)	915
SfcI	CTRYAG	2 cut(s)	835, 1183
SmiMI	CAYNNNNRTG	3 cut(s)	12, 33, 258
SmlI	CTYRAG	5 cut(s)	193, 329, 572, 1112, 1205
SmoI	CTYRAG	5 cut(s)	193, 329, 572, 1112, 1205
SpeI	ACTAGT	2 cut(s)	364, 752
Sse9I	AATT	3 cut(s)	463, 723, 1124
SspI	AATATT	1 cut(s)	48
SspMI	CTAG	4 cut(s)	365, 753, 1085, 1161
StyD4I	CCNGG	1 cut(s)	163
StyI	CCWWGG	1 cut(s)	1084
TaaI	ACNGT	1 cut(s)	232
TaqI	TCGA	3 cut(s)	153, 930, 1074
TasI	AATT	3 cut(s)	463, 723, 1124
TatI	WGTACW	2 cut(s)	135, 891
TfiI	GAWTC	5 cut(s)	219, 407, 879, 1108, 1154
Tru1I	TTAA	2 cut(s)	33, 552
Tru9I	TTAA	2 cut(s)	33, 552
TseFI	GTSAC	3 cut(s)	3, 567, 755
TseI	GCWGC	1 cut(s)	477
Tsp45I	GTSAC	3 cut(s)	3, 567, 755
TspDTI	ATGAA	4 cut(s)	498, 573, 788, 948
VspI	ATTAAT	1 cut(s)	33
XapI	RAATTY	3 cut(s)	463, 723, 1124
XmaJI	CCTAGG	1 cut(s)	1084
XmiI	GTMKAC	1 cut(s)	423
XmnI	GAANNNNTTC	1 cut(s)	324
XspI	CTAG	4 cut(s)	365, 753, 1085, 1161
ZrmI	AGTACT	1 cut(s)	137

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.