Rmu_sc0022743.1_g000001

Belongs to the Ca(2 ) cation antiporter (CaCA) (TC 2.A.19) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022743.1
Physical Location & Seq
Forward (+)
355 .. 3507
3153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022743.1_g000001.1.cds

Sequence Viewer

Length: 1530 bp
atggcttcaaaccaagaaccatggctgttggaaaatggcaaccccaaaggcctaactaaggagcaccggaagagatccgctcacaacaggtcctcctcttcactgaggaagaagtctgatcgtacgctcatctcgaaaattccatgttcacttcttagacaattcctggccaatctccaggaggttattttgggtaccaaactctcggttctattcccggccatcccggcagccattttggccgactcttttggctttggaagaccttgggtcttcgctctgagcctcattggactaatgccactagcagaacgtgttagtttcctcacagaacagattgcttttttcaccggtccaacagtgggagggcttcttaacgcgacatgtggcaacgccaccgagctgattatagctatctttgctctgagccaacacaaaatcacagtagtgaagtactcccttttgggatcgatactctccaaccttctgttggtcctcggcacctccctcttctgcggtggcattgctaacctcagaagggaacaaaaatatgacagaagacaagctgacgtgaactcattgatgctgctgctggcgctgctgtgtcacttgctgccactgctcttcactttcgccgcaggagagtccgtggctaccggagaccccacgctccatctgtcgagagctagcagcattatcatgctgattgcttacgctgcctacattgtcttccagctctggactcaccgcgagttatttgaagctcaggaggaatcggatgatgatgatgctgccgaggaagaagcggctgtaattggattctggagtggagagtccgtggctaccgtagaccccacgctccatctgtcgagagctagcagcattatcatgctgattgcttacgctgcctacattgtcttccagctctggactcaccgcgagttatttgaagctcaggaggaatcggatgatgatgacgctgccgaggaagaagcggctgtaattggattctggagtggttttgtgtggctggttggaatgactggagtcatagctttgttgtctgagtatatagtgggaacaattgaggaagcatccgattcttgggggttgtctgtgagcttcatcagcataatcctgctacctattgttggcaatgcagcagaacatgcaggagctgtcatttttgctttcaagaacaagctggatataactcttggtgttgcattgggttctgcaactcaaattgccatgtttgtggttccattttgtgtaattgtagcttggattatgggtattaacatggatctcaatttcagtctccttgagactggctctcttgctttatcaatcctagccacagccttcacattgcaggatggtacttctcactacctgaaaggactgattcttctgctgtgctacattattattggagcctgtttttttgtatctcaagctccacttaatggaccaaacagtgtcaatctgagacttaaaactacagctggatcagtctttggagcttaa

Protein Analysis

509

Amino Acids

55.11

Weight (kDa)

5.08

Isoelectric Point (pI)

36.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 194
AccB1I GGYRCC 2 cut(s) 194, 500
AccB7I CCANNNNNTGG 1 cut(s) 1469
AccBSI CCGCTC 1 cut(s) 80
AccI GTMKAC 1 cut(s) 849
AccII CGCG 3 cut(s) 380, 750, 939
AciI CCGC 7 cut(s) 78, 516, 636, 748, 806, 937, 995
AclWI GGATC 4 cut(s) 69, 475, 1314, 1519
AcoI YGGCCR 3 cut(s) 168, 219, 240
AcsI RAATTY 1 cut(s) 138
AfaI GTAC 4 cut(s) 124, 196, 455, 1384
AfiI CCNNNNNNNGG 7 cut(s) 58, 362, 490, 538, 1104, 1151, 1469
AflIII ACRYGT 2 cut(s) 313, 383
AgeI ACCGGT 1 cut(s) 350
AgsI TTSAA 4 cut(s) 9, 761, 950, 1195
AhdI GACNNNNNGTC 1 cut(s) 269
AjiI CACGTC 1 cut(s) 571
AjnI CCWGG 2 cut(s) 165, 177
AleI CACNNNNGTG 1 cut(s) 446
Alw21I GWGCWC 1 cut(s) 66
Alw26I GTCTC 4 cut(s) 654, 1322, 1325, 1486
AlwI GGATC 4 cut(s) 69, 475, 1314, 1519
AlwNI CAGNNNCTG 1 cut(s) 1178
AoxI GGCC 4 cut(s) 49, 168, 219, 240
ApoI RAATTY 1 cut(s) 138
AsiGI ACCGGT 1 cut(s) 350
Asp718I GGTACC 1 cut(s) 194
AspLEI GCGC 1 cut(s) 598
AspS9I GGNCC 4 cut(s) 90, 353, 493, 1472
AsuC2I CCSGG 2 cut(s) 218, 227
AsuHPI GGTGA 3 cut(s) 340, 737, 926
AsuNHI GCTAGC 2 cut(s) 686, 875
AvaII GGWCC 4 cut(s) 90, 353, 493, 1472
BalI TGGCCA 1 cut(s) 170
BanI GGYRCC 2 cut(s) 194, 500
BbsI GAAGAC 5 cut(s) 265, 268, 565, 721, 910
Bbv12I GWGCWC 1 cut(s) 66
BccI CCATC 4 cut(s) 230, 681, 870, 1373
BciT130I CCWGG 2 cut(s) 167, 179
BcnI CCSGG 2 cut(s) 218, 227
BcoDI GTCTC 4 cut(s) 654, 1322, 1325, 1486
BfaI CTAG 4 cut(s) 305, 687, 876, 1355
BfmI CTRYAG 1 cut(s) 1503
BfoI RGCGCY 1 cut(s) 599
BglI GCCNNNNNGGC 2 cut(s) 227, 239
BmcAI AGTACT 1 cut(s) 455
Bme1390I CCNGG 4 cut(s) 167, 179, 218, 227
Bme18I GGWCC 4 cut(s) 90, 353, 493, 1472
BmeRI GACNNNNNGTC 1 cut(s) 269
BmgBI CACGTC 1 cut(s) 571
BmgT120I GGNCC 4 cut(s) 90, 353, 493, 1472
BmiI GGNNCC 4 cut(s) 196, 502, 1263, 1438
BmrFI CCNGG 4 cut(s) 167, 179, 218, 227
BmsI GCATC 3 cut(s) 573, 778, 1103
BmtI GCTAGC 2 cut(s) 690, 879
BoxI GACNNNNGTC 1 cut(s) 1046
BpiI GAAGAC 5 cut(s) 265, 268, 565, 721, 910
BplI GAGNNNNNCTC 4 cut(s) 64, 96, 1319, 1351
BpmI CTGGAG 4 cut(s) 161, 844, 1033, 1065
Bpu10I CCTNAGC 2 cut(s) 765, 954
BpuEI CTTGAG 2 cut(s) 1346, 1440
BpuMI CCSGG 2 cut(s) 218, 227
Bsa29I ATCGAT 1 cut(s) 470
BsaI GGTCTC 1 cut(s) 654
BsaJI CCNNGG 7 cut(s) 20, 266, 496, 648, 795, 837, 984
BsaWI WCCGGW 3 cut(s) 66, 350, 656
BsaXI ACNNNNNCTCC 6 cut(s) 77, 107, 633, 663, 822, 852
Bsc4I CCNNNNNNNGG 7 cut(s) 58, 362, 490, 538, 1104, 1151, 1469
Bse118I RCCGGY 1 cut(s) 350
Bse1I ACTGG 2 cut(s) 1048, 1336
Bse3DI GCAATG 3 cut(s) 522, 1162, 1370
BseBI CCWGG 2 cut(s) 167, 179
BseCI ATCGAT 1 cut(s) 470
BseDI CCNNGG 7 cut(s) 20, 266, 496, 648, 795, 837, 984
BseGI GGATG 5 cut(s) 222, 784, 973, 1094, 1384
BseLI CCNNNNNNNGG 7 cut(s) 58, 362, 490, 538, 1104, 1151, 1469
BseMI GCAATG 3 cut(s) 522, 1162, 1370
BseMII CTCAG 8 cut(s) 95, 272, 416, 547, 779, 968, 1056, 1481
BseNI ACTGG 2 cut(s) 1048, 1336
BseRI GAGGAG 1 cut(s) 85
Bsh1236I CGCG 3 cut(s) 380, 750, 939
BshFI GGCC 4 cut(s) 51, 170, 221, 242
BshNI GGYRCC 2 cut(s) 194, 500
BshTI ACCGGT 1 cut(s) 350
BshVI ATCGAT 1 cut(s) 470
BsiHKAI GWGCWC 1 cut(s) 66
BsiSI CCGG 5 cut(s) 67, 218, 227, 351, 657
BsiWI CGTACG 1 cut(s) 122
BslI CCNNNNNNNGG 7 cut(s) 58, 362, 490, 538, 1104, 1151, 1469
BsmAI GTCTC 4 cut(s) 654, 1322, 1325, 1486
BsnI GGCC 4 cut(s) 51, 170, 221, 242
Bso31I GGTCTC 1 cut(s) 654
Bsp1286I GDGCHC 1 cut(s) 66
Bsp143I GATC 5 cut(s) 74, 118, 467, 1306, 1511
Bsp19I CCATGG 1 cut(s) 20
BspACI CCGC 7 cut(s) 78, 516, 636, 748, 806, 937, 995
BspANI GGCC 4 cut(s) 51, 170, 221, 242
BspCNI CTCAG 8 cut(s) 96, 273, 417, 546, 778, 967, 1057, 1482
BspDI ATCGAT 1 cut(s) 470
BspFNI CGCG 3 cut(s) 380, 750, 939
BspLI GGNNCC 4 cut(s) 196, 502, 1263, 1438
BspOI GCTAGC 2 cut(s) 690, 879
BspPI GGATC 4 cut(s) 69, 475, 1314, 1519
BspQI GCTCTTC 1 cut(s) 629
BspT107I GGYRCC 2 cut(s) 194, 500
BspTNI GGTCTC 1 cut(s) 654
BsrBI CCGCTC 1 cut(s) 80
BsrDI GCAATG 3 cut(s) 522, 1162, 1370
BsrFI RCCGGY 1 cut(s) 350
BsrI ACTGG 2 cut(s) 1048, 1336
BssAI RCCGGY 1 cut(s) 350
BssECI CCNNGG 7 cut(s) 20, 266, 496, 648, 795, 837, 984
BssMI GATC 5 cut(s) 74, 118, 467, 1306, 1511
BssT1I CCWWGG 2 cut(s) 20, 266
Bst2UI CCWGG 2 cut(s) 167, 179
Bst4CI ACNGT 4 cut(s) 361, 445, 847, 1481
Bst6I CTCTTC 4 cut(s) 65, 103, 515, 629
BstAPI GCANNNNNTGC 1 cut(s) 1169
BstC8I GCNNGC 3 cut(s) 594, 688, 877
BstDSI CCRYGG 3 cut(s) 20, 648, 837
BstENI CCTNNNNNAGG 1 cut(s) 56
BstF5I GGATG 5 cut(s) 222, 784, 973, 1094, 1384
BstFNI CGCG 3 cut(s) 380, 750, 939
BstH2I RGCGCY 1 cut(s) 599
BstHHI GCGC 1 cut(s) 598
BstKTI GATC 5 cut(s) 77, 121, 470, 1309, 1514
BstMAI GTCTC 4 cut(s) 654, 1322, 1325, 1486
BstMBI GATC 5 cut(s) 74, 118, 467, 1306, 1511
BstNI CCWGG 2 cut(s) 167, 179
BstNSI RCATGY 2 cut(s) 387, 1172
BstPAI GACNNNNGTC 1 cut(s) 1046
BstSCI CCNGG 4 cut(s) 165, 177, 216, 225
BstSFI CTRYAG 1 cut(s) 1503
BstUI CGCG 3 cut(s) 380, 750, 939
BstV2I GAAGAC 5 cut(s) 265, 268, 565, 721, 910
BstX2I RGATCY 2 cut(s) 74, 1306
BstXI CCANNNNNNTGG 1 cut(s) 1258
BstYI RGATCY 2 cut(s) 74, 1306
Bsu15I ATCGAT 1 cut(s) 470
BsuRI GGCC 4 cut(s) 51, 170, 221, 242
BsuTUI ATCGAT 1 cut(s) 470
BtgI CCRYGG 3 cut(s) 20, 648, 837
BtrI CACGTC 1 cut(s) 571
BtsCI GGATG 5 cut(s) 222, 784, 973, 1094, 1384
BtsI GCAGTG 1 cut(s) 617
BtsIMutI CAGTG 4 cut(s) 101, 366, 617, 1486
Cac8I GCNNGC 3 cut(s) 594, 688, 877
CaiI CAGNNNCTG 1 cut(s) 1178
CfoI GCGC 1 cut(s) 598
Cfr10I RCCGGY 1 cut(s) 350
Cfr13I GGNCC 4 cut(s) 90, 353, 493, 1472
ClaI ATCGAT 1 cut(s) 470
CseI GACGC 1 cut(s) 986
Csp6I GTAC 4 cut(s) 123, 195, 454, 1383
CspAI ACCGGT 1 cut(s) 350
CviAII CATG 8 cut(s) 21, 144, 384, 700, 889, 1169, 1252, 1303
CviQI GTAC 4 cut(s) 123, 195, 454, 1383
DpnI GATC 5 cut(s) 76, 120, 469, 1308, 1513
DpnII GATC 5 cut(s) 74, 118, 467, 1306, 1511
DriI GACNNNNNGTC 1 cut(s) 269
EaeI YGGCCR 3 cut(s) 168, 219, 240
Eam1104I CTCTTC 4 cut(s) 65, 103, 515, 629
Eam1105I GACNNNNNGTC 1 cut(s) 269
EarI CTCTTC 4 cut(s) 65, 103, 515, 629
Eco130I CCWWGG 2 cut(s) 20, 266
Eco147I AGGCCT 1 cut(s) 51
Eco31I GGTCTC 1 cut(s) 654
Eco47I GGWCC 4 cut(s) 90, 353, 493, 1472
EcoNI CCTNNNNNAGG 1 cut(s) 56
EcoO109I RGGNCCY 1 cut(s) 90
EcoRII CCWGG 2 cut(s) 165, 177
EcoT14I CCWWGG 2 cut(s) 20, 266
ErhI CCWWGG 2 cut(s) 20, 266
FaeI CATG 8 cut(s) 24, 147, 387, 703, 892, 1172, 1255, 1306
FalI AAGNNNNNCTT 2 cut(s) 1449, 1481
FatI CATG 8 cut(s) 20, 143, 383, 699, 888, 1168, 1251, 1302
FblI GTMKAC 1 cut(s) 849
FokI GGATG 5 cut(s) 209, 791, 980, 1081, 1391
FspBI CTAG 4 cut(s) 305, 687, 876, 1355
GlaI GCGC 1 cut(s) 597
GsuI CTGGAG 4 cut(s) 161, 844, 1033, 1065
HaeII RGCGCY 1 cut(s) 599
HaeIII GGCC 4 cut(s) 51, 170, 221, 242
HapII CCGG 5 cut(s) 67, 218, 227, 351, 657
HgaI GACGC 1 cut(s) 986
HhaI GCGC 1 cut(s) 598
Hin1II CATG 8 cut(s) 24, 147, 387, 703, 892, 1172, 1255, 1306
Hin6I GCGC 1 cut(s) 596
HinP1I GCGC 1 cut(s) 596
HpaII CCGG 5 cut(s) 67, 218, 227, 351, 657
HphI GGTGA 3 cut(s) 340, 737, 926
Hpy166II GTNNAC 3 cut(s) 149, 574, 850
Hpy188I TCNGA 9 cut(s) 118, 282, 426, 536, 778, 967, 1066, 1099, 1491
Hpy8I GTNNAC 3 cut(s) 149, 574, 850
HpyAV CCTTC 3 cut(s) 494, 531, 1375
HpyCH4III ACNGT 4 cut(s) 361, 445, 847, 1481
HpyCH4IV ACGT 2 cut(s) 313, 570
HpyCH4V TGCA 5 cut(s) 1160, 1172, 1226, 1238, 1375
HpySE526I ACGT 2 cut(s) 313, 570
Hsp92II CATG 8 cut(s) 24, 147, 387, 703, 892, 1172, 1255, 1306
HspAI GCGC 1 cut(s) 596
KpnI GGTACC 1 cut(s) 198
Kzo9I GATC 5 cut(s) 74, 118, 467, 1306, 1511
LguI GCTCTTC 1 cut(s) 629
LmnI GCTCC 7 cut(s) 61, 675, 864, 1175, 1436, 1465, 1523
LweI GCATC 3 cut(s) 573, 778, 1103
MaeI CTAG 4 cut(s) 305, 687, 876, 1355
MaeII ACGT 2 cut(s) 313, 570
MaeIII GTNAC 1 cut(s) 605
MalI GATC 5 cut(s) 76, 120, 469, 1308, 1513
MbiI CCGCTC 1 cut(s) 80
MboI GATC 5 cut(s) 74, 118, 467, 1306, 1511
MfeI CAATTG 1 cut(s) 1083
MflI RGATCY 2 cut(s) 74, 1306
MhlI GDGCHC 1 cut(s) 66
MlsI TGGCCA 1 cut(s) 170
MluCI AATT 8 cut(s) 138, 161, 813, 1002, 1083, 1245, 1275, 1312
MluNI TGGCCA 1 cut(s) 170
MlyI GAGTC 6 cut(s) 239, 653, 736, 842, 925, 1056
MmeI TCCRAC 4 cut(s) 9, 380, 504, 1015
Mox20I TGGCCA 1 cut(s) 170
MscI TGGCCA 1 cut(s) 170
MseI TTAA 5 cut(s) 375, 1299, 1467, 1497, 1528
MslI CAYNNNNRTG 4 cut(s) 446, 698, 887, 1256
Msp20I TGGCCA 1 cut(s) 170
MspA1I CMGCKG 1 cut(s) 1508
MspI CCGG 5 cut(s) 67, 218, 227, 351, 657
MspR9I CCNGG 4 cut(s) 167, 179, 218, 227
MunI CAATTG 1 cut(s) 1083
MvaI CCWGG 2 cut(s) 167, 179
MvnI CGCG 3 cut(s) 380, 750, 939
NciI CCSGG 2 cut(s) 218, 227
NcoI CCATGG 1 cut(s) 20
NdeII GATC 5 cut(s) 74, 118, 467, 1306, 1511
NheI GCTAGC 2 cut(s) 686, 875
NlaIII CATG 8 cut(s) 24, 147, 387, 703, 892, 1172, 1255, 1306
NlaIV GGNNCC 4 cut(s) 196, 502, 1263, 1438
NmeAIII GCCGAG 3 cut(s) 477, 820, 1009
NmuCI GTSAC 1 cut(s) 605
NspI RCATGY 2 cut(s) 387, 1172
OliI CACNNNNGTG 1 cut(s) 446
PceI AGGCCT 1 cut(s) 51
PciI ACATGT 1 cut(s) 383
PciSI GCTCTTC 1 cut(s) 629
PcsI WCGNNNNNNNCGW 1 cut(s) 131
PfeI GAWTC 6 cut(s) 773, 819, 962, 1008, 1100, 1408
Pfl23II CGTACG 1 cut(s) 122
PflMI CCANNNNNTGG 1 cut(s) 1469
PfoI TCCNGGA 1 cut(s) 177
PinAI ACCGGT 1 cut(s) 350
PleI GAGTC 6 cut(s) 239, 652, 736, 841, 925, 1055
PpsI GAGTC 6 cut(s) 239, 652, 736, 841, 925, 1055
PpuMI RGGWCCY 1 cut(s) 90
PscI ACATGT 1 cut(s) 383
PshAI GACNNNNGTC 1 cut(s) 1046
Psp5II RGGWCCY 1 cut(s) 90
Psp6I CCWGG 2 cut(s) 165, 177
PspGI CCWGG 2 cut(s) 165, 177
PspLI CGTACG 1 cut(s) 122
PspN4I GGNNCC 4 cut(s) 196, 502, 1263, 1438
PspPI GGNCC 4 cut(s) 90, 353, 493, 1472
PspPPI RGGWCCY 1 cut(s) 90
PstNI CAGNNNCTG 1 cut(s) 1178
PsuI RGATCY 2 cut(s) 74, 1306
PvuII CAGCTG 1 cut(s) 1508
RsaI GTAC 4 cut(s) 124, 196, 455, 1384
RsaNI GTAC 4 cut(s) 123, 195, 454, 1383
RseI CAYNNNNRTG 4 cut(s) 446, 698, 887, 1256
SapI GCTCTTC 1 cut(s) 629
SaqAI TTAA 5 cut(s) 375, 1299, 1467, 1497, 1528
Sau3AI GATC 5 cut(s) 74, 118, 467, 1306, 1511
Sau96I GGNCC 4 cut(s) 90, 353, 493, 1472
ScaI AGTACT 1 cut(s) 455
SchI GAGTC 6 cut(s) 239, 653, 736, 842, 925, 1056
ScrFI CCNGG 4 cut(s) 167, 179, 218, 227
SduI GDGCHC 1 cut(s) 66
SfaNI GCATC 3 cut(s) 573, 778, 1103
SfcI CTRYAG 1 cut(s) 1503
SinI GGWCC 4 cut(s) 90, 353, 493, 1472
SmiMI CAYNNNNRTG 4 cut(s) 446, 698, 887, 1256
SmlI CTYRAG 2 cut(s) 1325, 1455
SmoI CTYRAG 2 cut(s) 1325, 1455
Sse9I AATT 8 cut(s) 138, 161, 813, 1002, 1083, 1245, 1275, 1312
SseBI AGGCCT 1 cut(s) 51
SsiI CCGC 7 cut(s) 78, 516, 636, 748, 806, 937, 995
SspMI CTAG 4 cut(s) 305, 687, 876, 1355
StuI AGGCCT 1 cut(s) 51
StyD4I CCNGG 4 cut(s) 165, 177, 216, 225
StyI CCWWGG 2 cut(s) 20, 266
TaaI ACNGT 4 cut(s) 361, 445, 847, 1481
TaiI ACGT 2 cut(s) 316, 573
TaqI TCGA 4 cut(s) 134, 470, 680, 869
TasI AATT 8 cut(s) 138, 161, 813, 1002, 1083, 1245, 1275, 1312
TatI WGTACW 1 cut(s) 453
TauI GCSGC 3 cut(s) 638, 809, 998
TfiI GAWTC 6 cut(s) 773, 819, 962, 1008, 1100, 1408
Tru1I TTAA 5 cut(s) 375, 1299, 1467, 1497, 1528
Tru9I TTAA 5 cut(s) 375, 1299, 1467, 1497, 1528
TscAI CASTG 4 cut(s) 108, 366, 624, 1486
TseFI GTSAC 1 cut(s) 605
Tsp45I GTSAC 1 cut(s) 605
TspDTI ATGAA 1 cut(s) 1114
TspGWI ACGGA 2 cut(s) 637, 826
TspRI CASTG 4 cut(s) 108, 366, 624, 1486
Van91I CCANNNNNTGG 1 cut(s) 1469
VpaK11BI GGWCC 4 cut(s) 90, 353, 493, 1472
XagI CCTNNNNNAGG 1 cut(s) 56
XapI RAATTY 1 cut(s) 138
XceI RCATGY 2 cut(s) 387, 1172
XcmI CCANNNNNNNNNTGG 1 cut(s) 487
XmiI GTMKAC 1 cut(s) 849
XspI CTAG 4 cut(s) 305, 687, 876, 1355
ZrmI AGTACT 1 cut(s) 455
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.