Rmu_sc0026738.1_g000004

Glucose and ribitol

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026738.1
Physical Location & Seq
Reverse (-)
13883 .. 14936
1054 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026738.1_g000004.1.cds

Sequence Viewer

Length: 882 bp
atggcttctggtggcaatcagaaatttcctcctcaaaagcaagaatctcaacctggaaaagagcatgtcatgaaccctaaccctcagtactcaaacccggattacaaaccctccaataagctccaagggaaggtagcactagtgacaggtggagactccgggatagggcgagcggtgtgccattgctttgctcaggagggtgcaacagtggccttcacctttgtgaagggtcaggaggaccaggatgcacacgacacgcttgaaatgatcaagaaggtgaaaactcctgattccaaggatccaatggcagttgcagctgatcttggttttgatgagaattgcaagaaggtcgtagaggaggtgacaaaagcatatggatgcattgatattctggttaacaatgcagcagagcagtacaagaacagctcggtggcagagattgatgagtctcgtcttgaaagggtgttcagaaccaatatcttttcttacttttttgtgacaaggcacgctttgaatcacatgaaaaaaggcagcagcataatttgctcaacatcagttaatgcatacaagggaaaccagaagctgcttgattatacagcaacaaagggagccattgtggcatttgtaagaggattgtcacttgagctagtgaacaaaggcatccgtgtcaatggtgtagctcctggaccaatatggaccccattgattccagcatctttcgatgaggaggaaaccgcaaactttggctctgaagtgccaatgcagcgagctgggcagccctgtgaggttgcgccatcctatgtcttccttgcttccaatgctttctcttcttatataagtggccaagtgatccatcctaatggtaatgttctgctactatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

293

Amino Acids

31.81

Weight (kDa)

6.32

Isoelectric Point (pI)

27.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 173
AciI CCGC 2 cut(s) 173, 735
AclWI GGATC 3 cut(s) 293, 306, 844
AcoI YGGCCR 1 cut(s) 841
AcsI RAATTY 1 cut(s) 23
AcuI CTGAAG 1 cut(s) 771
AfaI GTAC 2 cut(s) 89, 416
AfiI CCNNNNNNNGG 2 cut(s) 130, 165
AgsI TTSAA 3 cut(s) 263, 458, 514
AhlI ACTAGT 1 cut(s) 139
AjnI CCWGG 3 cut(s) 52, 240, 682
AleI CACNNNNGTG 1 cut(s) 221
AluBI AGCT 7 cut(s) 121, 317, 426, 583, 646, 680, 770
AluI AGCT 7 cut(s) 121, 317, 426, 583, 646, 680, 770
Alw26I GTCTC 2 cut(s) 147, 453
AlwI GGATC 3 cut(s) 293, 306, 844
AlwNI CAGNNNCTG 1 cut(s) 583
AoxI GGCC 2 cut(s) 210, 841
ApeKI GCWGC 7 cut(s) 314, 404, 531, 534, 583, 763, 775
ApoI RAATTY 1 cut(s) 23
AspLEI GCGC 1 cut(s) 793
AspS9I GGNCC 3 cut(s) 238, 686, 696
AsuC2I CCSGG 2 cut(s) 98, 160
AsuHPI GGTGA 3 cut(s) 208, 289, 373
AvaII GGWCC 3 cut(s) 238, 686, 696
BalI TGGCCA 1 cut(s) 843
BamHI GGATCC 1 cut(s) 298
BbsI GAAGAC 1 cut(s) 796
BbvI GCAGC 7 cut(s) 326, 416, 543, 546, 570, 775, 787
BccI CCATC 2 cut(s) 802, 861
BcgI CGANNNNNNTGC 4 cut(s) 159, 193, 331, 365
BciT130I CCWGG 3 cut(s) 54, 242, 684
BclI TGATCA 1 cut(s) 267
BcnI CCSGG 2 cut(s) 98, 160
BcoDI GTCTC 2 cut(s) 147, 453
BcuI ACTAGT 1 cut(s) 139
BfaI CTAG 2 cut(s) 140, 647
BfmI CTRYAG 1 cut(s) 878
BglI GCCNNNNNGGC 1 cut(s) 617
BisI GCNGC 7 cut(s) 315, 405, 532, 535, 584, 764, 776
BlsI GCNGC 7 cut(s) 316, 406, 533, 536, 585, 765, 777
BmcAI AGTACT 1 cut(s) 89
Bme1390I CCNGG 5 cut(s) 54, 98, 160, 242, 684
Bme18I GGWCC 3 cut(s) 238, 686, 696
BmgT120I GGNCC 3 cut(s) 238, 686, 696
BmiI GGNNCC 3 cut(s) 300, 610, 698
BmrFI CCNGG 5 cut(s) 54, 98, 160, 242, 684
BmsI GCATC 4 cut(s) 235, 368, 669, 722
BpiI GAAGAC 1 cut(s) 796
Bpu10I CCTNAGC 1 cut(s) 192
BpuEI CTTGAG 1 cut(s) 662
BpuMI CCSGG 2 cut(s) 98, 160
BsaJI CCNNGG 2 cut(s) 124, 294
BsaXI ACNNNNNCTCC 4 cut(s) 95, 125, 600, 630
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 165
Bse3DI GCAATG 1 cut(s) 181
BseBI CCWGG 3 cut(s) 54, 242, 684
BseDI CCNNGG 2 cut(s) 124, 294
BseGI GGATG 5 cut(s) 250, 383, 660, 794, 853
BseLI CCNNNNNNNGG 2 cut(s) 130, 165
BseMI GCAATG 1 cut(s) 181
BseMII CTCAG 2 cut(s) 98, 206
BseRI GAGGAG 3 cut(s) 21, 371, 740
BseXI GCAGC 7 cut(s) 326, 416, 543, 546, 570, 775, 787
BseYI CCCAGC 1 cut(s) 770
BshFI GGCC 2 cut(s) 212, 843
BsiSI CCGG 2 cut(s) 98, 159
BslI CCNNNNNNNGG 2 cut(s) 130, 165
BsmAI GTCTC 2 cut(s) 147, 453
BsnI GGCC 2 cut(s) 212, 843
Bsp143I GATC 4 cut(s) 267, 298, 319, 849
BspACI CCGC 2 cut(s) 173, 735
BspANI GGCC 2 cut(s) 212, 843
BspCNI CTCAG 2 cut(s) 97, 205
BspHI TCATGA 1 cut(s) 69
BspLI GGNNCC 3 cut(s) 300, 610, 698
BspPI GGATC 3 cut(s) 293, 306, 844
BsrBI CCGCTC 1 cut(s) 173
BsrDI GCAATG 1 cut(s) 181
BssECI CCNNGG 2 cut(s) 124, 294
BssMI GATC 4 cut(s) 267, 298, 319, 849
BssT1I CCWWGG 2 cut(s) 124, 294
Bst2UI CCWGG 3 cut(s) 54, 242, 684
Bst4CI ACNGT 1 cut(s) 208
Bst6I CTCTTC 1 cut(s) 832
BstAPI GCANNNNNTGC 1 cut(s) 543
BstC8I GCNNGC 3 cut(s) 171, 507, 768
BstDEI CTNAG 2 cut(s) 84, 192
BstF5I GGATG 5 cut(s) 250, 383, 660, 794, 853
BstHHI GCGC 1 cut(s) 793
BstKTI GATC 4 cut(s) 270, 301, 322, 852
BstMAI GTCTC 2 cut(s) 147, 453
BstMBI GATC 4 cut(s) 267, 298, 319, 849
BstMWI GCNNNNNNNGC 7 cut(s) 209, 314, 543, 617, 763, 772, 818
BstNI CCWGG 3 cut(s) 54, 242, 684
BstNSI RCATGY 1 cut(s) 68
BstSCI CCNGG 5 cut(s) 52, 96, 158, 240, 682
BstSFI CTRYAG 1 cut(s) 878
BstV1I GCAGC 7 cut(s) 326, 416, 543, 546, 570, 775, 787
BstV2I GAAGAC 1 cut(s) 796
BstX2I RGATCY 1 cut(s) 298
BstXI CCANNNNNNTGG 1 cut(s) 860
BstYI RGATCY 1 cut(s) 298
BsuRI GGCC 2 cut(s) 212, 843
BtsCI GGATG 5 cut(s) 250, 383, 660, 794, 853
BtsIMutI CAGTG 1 cut(s) 213
Cac8I GCNNGC 3 cut(s) 171, 507, 768
CaiI CAGNNNCTG 1 cut(s) 583
CciI TCATGA 1 cut(s) 69
CfoI GCGC 1 cut(s) 793
Cfr13I GGNCC 3 cut(s) 238, 686, 696
Csp6I GTAC 2 cut(s) 88, 415
CviAII CATG 3 cut(s) 65, 70, 520
CviQI GTAC 2 cut(s) 88, 415
DdeI CTNAG 2 cut(s) 84, 192
DpnI GATC 4 cut(s) 269, 300, 321, 851
DpnII GATC 4 cut(s) 267, 298, 319, 849
EaeI YGGCCR 1 cut(s) 841
Eam1104I CTCTTC 1 cut(s) 832
EarI CTCTTC 1 cut(s) 832
Eco130I CCWWGG 2 cut(s) 124, 294
Eco47I GGWCC 3 cut(s) 238, 686, 696
Eco57I CTGAAG 1 cut(s) 771
EcoRII CCWGG 3 cut(s) 52, 240, 682
EcoT14I CCWWGG 2 cut(s) 124, 294
EcoT22I ATGCAT 2 cut(s) 383, 565
ErhI CCWWGG 2 cut(s) 124, 294
FaeI CATG 3 cut(s) 68, 73, 523
FalI AAGNNNNNCTT 2 cut(s) 493, 525
FatI CATG 3 cut(s) 64, 69, 519
FauNDI CATATG 1 cut(s) 373
FbaI TGATCA 1 cut(s) 267
Fnu4HI GCNGC 7 cut(s) 315, 405, 532, 535, 584, 764, 776
FokI GGATG 5 cut(s) 257, 390, 647, 781, 840
Fsp4HI GCNGC 7 cut(s) 315, 405, 532, 535, 584, 764, 776
FspBI CTAG 2 cut(s) 140, 647
GlaI GCGC 1 cut(s) 792
GluI GCNGC 7 cut(s) 315, 405, 532, 535, 584, 764, 776
GsaI CCCAGC 1 cut(s) 774
HaeIII GGCC 2 cut(s) 212, 843
HapII CCGG 2 cut(s) 98, 159
HhaI GCGC 1 cut(s) 793
Hin1II CATG 3 cut(s) 68, 73, 523
Hin6I GCGC 1 cut(s) 791
HinP1I GCGC 1 cut(s) 791
HincII GTYRAC 1 cut(s) 397
HindII GTYRAC 1 cut(s) 397
HinfI GANTC 6 cut(s) 44, 155, 290, 446, 514, 706
HpaI GTTAAC 1 cut(s) 397
HpaII CCGG 2 cut(s) 98, 159
HphI GGTGA 3 cut(s) 208, 289, 373
Hpy166II GTNNAC 2 cut(s) 397, 652
Hpy188I TCNGA 3 cut(s) 21, 470, 751
Hpy188III TCNNGA 6 cut(s) 70, 194, 233, 271, 287, 455
Hpy8I GTNNAC 2 cut(s) 397, 652
HpyAV CCTTC 5 cut(s) 124, 220, 223, 268, 340
HpyCH4III ACNGT 1 cut(s) 208
HpyCH4V TGCA 8 cut(s) 203, 248, 314, 342, 381, 404, 563, 763
HpyF10VI GCNNNNNNNGC 7 cut(s) 209, 314, 543, 617, 763, 772, 818
HpyF3I CTNAG 2 cut(s) 84, 192
Hsp92II CATG 3 cut(s) 68, 73, 523
HspAI GCGC 1 cut(s) 791
Ksp22I TGATCA 1 cut(s) 267
KspAI GTTAAC 1 cut(s) 397
Kzo9I GATC 4 cut(s) 267, 298, 319, 849
LmnI GCTCC 3 cut(s) 126, 608, 685
Lsp1109I GCAGC 7 cut(s) 326, 416, 543, 546, 570, 775, 787
LweI GCATC 4 cut(s) 235, 368, 669, 722
MaeI CTAG 2 cut(s) 140, 647
MaeIII GTNAC 4 cut(s) 142, 361, 496, 636
MalI GATC 4 cut(s) 269, 300, 321, 851
MbiI CCGCTC 1 cut(s) 173
MboI GATC 4 cut(s) 267, 298, 319, 849
MboII GAAGA 2 cut(s) 796, 819
MflI RGATCY 1 cut(s) 298
MlsI TGGCCA 1 cut(s) 843
MluCI AATT 3 cut(s) 23, 337, 540
MluNI TGGCCA 1 cut(s) 843
MlyI GAGTC 2 cut(s) 149, 455
Mox20I TGGCCA 1 cut(s) 843
Mph1103I ATGCAT 2 cut(s) 383, 565
MscI TGGCCA 1 cut(s) 843
MseI TTAA 2 cut(s) 396, 558
MslI CAYNNNNRTG 3 cut(s) 221, 376, 858
Msp20I TGGCCA 1 cut(s) 843
MspA1I CMGCKG 1 cut(s) 317
MspI CCGG 2 cut(s) 98, 159
MspR9I CCNGG 5 cut(s) 54, 98, 160, 242, 684
MvaI CCWGG 3 cut(s) 54, 242, 684
MwoI GCNNNNNNNGC 7 cut(s) 209, 314, 543, 617, 763, 772, 818
NciI CCSGG 2 cut(s) 98, 160
NdeI CATATG 1 cut(s) 373
NdeII GATC 4 cut(s) 267, 298, 319, 849
NlaIII CATG 3 cut(s) 68, 73, 523
NlaIV GGNNCC 3 cut(s) 300, 610, 698
NmuCI GTSAC 4 cut(s) 142, 361, 496, 636
NsiI ATGCAT 2 cut(s) 383, 565
NspI RCATGY 1 cut(s) 68
OliI CACNNNNGTG 1 cut(s) 221
PagI TCATGA 1 cut(s) 69
PfeI GAWTC 4 cut(s) 44, 290, 514, 706
PfoI TCCNGGA 2 cut(s) 158, 682
PkrI GCNGC 7 cut(s) 316, 406, 533, 536, 585, 765, 777
PleI GAGTC 2 cut(s) 149, 454
PpsI GAGTC 2 cut(s) 149, 454
Psp6I CCWGG 3 cut(s) 52, 240, 682
PspFI CCCAGC 1 cut(s) 770
PspGI CCWGG 3 cut(s) 52, 240, 682
PspN4I GGNNCC 3 cut(s) 300, 610, 698
PspPI GGNCC 3 cut(s) 238, 686, 696
PstNI CAGNNNCTG 1 cut(s) 583
PsuI RGATCY 1 cut(s) 298
PvuII CAGCTG 1 cut(s) 317
RsaI GTAC 2 cut(s) 89, 416
RsaNI GTAC 2 cut(s) 88, 415
RseI CAYNNNNRTG 3 cut(s) 221, 376, 858
SaqAI TTAA 2 cut(s) 396, 558
SatI GCNGC 7 cut(s) 315, 405, 532, 535, 584, 764, 776
Sau3AI GATC 4 cut(s) 267, 298, 319, 849
Sau96I GGNCC 3 cut(s) 238, 686, 696
ScaI AGTACT 1 cut(s) 89
SchI GAGTC 2 cut(s) 149, 455
ScrFI CCNGG 5 cut(s) 54, 98, 160, 242, 684
SfaNI GCATC 4 cut(s) 235, 368, 669, 722
SfcI CTRYAG 1 cut(s) 878
SinI GGWCC 3 cut(s) 238, 686, 696
SmiMI CAYNNNNRTG 3 cut(s) 221, 376, 858
SmlI CTYRAG 1 cut(s) 641
SmoI CTYRAG 1 cut(s) 641
SpeI ACTAGT 1 cut(s) 139
Sse9I AATT 3 cut(s) 23, 337, 540
SsiI CCGC 2 cut(s) 173, 735
SspMI CTAG 2 cut(s) 140, 647
StyD4I CCNGG 5 cut(s) 52, 96, 158, 240, 682
StyI CCWWGG 2 cut(s) 124, 294
TaaI ACNGT 1 cut(s) 208
TaqI TCGA 1 cut(s) 720
TasI AATT 3 cut(s) 23, 337, 540
TatI WGTACW 2 cut(s) 87, 414
TfiI GAWTC 4 cut(s) 44, 290, 514, 706
Tru1I TTAA 2 cut(s) 396, 558
Tru9I TTAA 2 cut(s) 396, 558
TscAI CASTG 1 cut(s) 213
TseFI GTSAC 4 cut(s) 142, 361, 496, 636
TseI GCWGC 7 cut(s) 314, 404, 531, 534, 583, 763, 775
Tsp45I GTSAC 4 cut(s) 142, 361, 496, 636
TspDTI ATGAA 2 cut(s) 86, 536
TspGWI ACGGA 1 cut(s) 653
TspRI CASTG 1 cut(s) 213
VpaK11BI GGWCC 3 cut(s) 238, 686, 696
XapI RAATTY 1 cut(s) 23
XceI RCATGY 1 cut(s) 68
XcmI CCANNNNNNNNNTGG 1 cut(s) 301
XspI CTAG 2 cut(s) 140, 647
ZrmI AGTACT 1 cut(s) 89
Zsp2I ATGCAT 2 cut(s) 383, 565
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.