Rmu_sc0028326.1_g000005

Zein-binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028326.1
Physical Location & Seq
Forward (+)
19137 .. 24598
5462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028326.1_g000005.1.cds

Sequence Viewer

Length: 2886 bp
atggcatgccaaatgatacattcatggacattcagtgggcttgtgggtgcatttcttgatcttgcaatagcctatctcttactctgtgcctcagctcttgcgttttttacctcgaagtttttggatgtctttggattaagtcttccatgcccttgtgatgggctgtttgggaacccaaagaataattactgcttccagaagcagttagtggatggcccatctgagaaaatcggtggagttcagttgcagctgaagagcaagttccctttcgatgtaatgtggagtgaagacccacattttcatgcaaagtcgaagtcggaccatgagaatgggcactttgtgtttgaaggtgaagcatcgtgtagctcttattcggatgggaagttgctagatgtggctgggagggcttgctctgtttcggggaatgaaatgagttttgagtctggtgcggtgaatttggaaaaatgctttgatcataagggaaagaaggttggtggtcgaaggccaagtcatagtctgcgccgccggcgcaagggggcctctttggattatggaaagctgttttcagtttcctcaagtgatatggtacagtcagattcccaagacatggctggacctccttacagaaatagtaaaatgggggacgaggttactgaagttcccgtcaattcaggaaggccaagtcatggtattcaccgccgccgcaaggggcgttctgttgattatggaaagatattttcggtttcaccatatgatagttcagatagaagagacattcctacacctccttccagcataagtaaagtggggaacaacggtagtgaagttccttccagttcagatggcatggaagctccaacagacactggtgggtcagaaagagtttcacatcttgagttgaatgaacatgttggtaaaactaaatcaattcagaatgatgcttcttctgttgaaaatttaggctgcaatgagcaagagaagccagtttatgacggtaatgataaaactatggttcgggtattggaacaagcactagacgaagagcatactgctcgtactgctctttattatgaattggagaaggagagaagtgctgctgctactgcggcagatgaggccatggcaatgatattgcgtctgcaagaagagaaggcatcaattgaaatggaggcaaggcaataccagaggatgatacaggaaaaatcagcttatgatgctgaggaaatgaacattctcaaagagatcttacttaggagagaaagggaaaagcatttcttggagaaggaagttgaatactacaggcaaatactttttgggaacgatcaagttgatgatgacatgcatgatgttgctgccacacaagcacaaagtatttctctgcattcaagtgaagagctggtgtcgatgcaggagcggacaaactattcaattagtgagaagtcaaagttgaaaatggcaaatagttctccagattacggggccctatcaagtgactcacaaaatcgcactctggccttggggaaagaactaccagttctggatttggaagaagatgacacttcgaagcatgtggacatgcacttgcttccaagcactgacagccattcacatatcttaaatagtaggtatgagatcagtcacgagtttcaagagaagggaatggtgtctgtggatgagagaccagtttctcggggaaaagaggtccaggtagtgaatgctgagggacttgaattggttgaaaaaactattcctccgaacgaacaggaacttgctttagctggtagcaatgtggatcatggaagcaaagatccacctcgcttaacgtctaatacagagcctcgtgttcatgatattcatgttattgacgataagtctgatttgtataatgaaaagagggcagagaaaagtgaacagctagtagcaaatgctaccttagatatttctgaaaaacacaagagtatgacagggttgggaaccgagcttaaagtgcacaaagttggttcagacagtggattgccaatagtggatggctctcaaggcaaagctttaccttacaatatgcggaggaattccatgtctgaggttgattatgaaagatcgaaaatagacagtaaactgcaccgaggtggtccagacatggcacctaattgcatgcggaggaattccatgtctgcaattgattatgacagatggaaaattgacaacaaagtggacagaggtagctcagacacggaacctaaagatgtgcggaggaattccatgactgcagttgattatgaaagatggaaaatggccaataaatcatacagaggtagttcagacacgtcgccatcaccttctgtcatgcgaagaaattccatgtctgcagttgattatgaaagatgcaaacttgacaatgaagttgagtggcttagagaaaggttaaggattgtgcaagagggaagagagaagcccaacctcccagtgggccacagagaaagggaaaaagttcagctgaaacttttggaagatatagcaggccaactccaagagattcggcaattgacggaacctggaaaggtcaagtgccaggctgcattgccgcctccatcatctaaggttatgtcaaagaaaagacgatggcgaactttgtctctaggacccaacctcccacgcagcacaaccctgatacctgcacaggctctttgcccttcaccggcctctgccattcaccgccgttgctgcaccggcccccagcccagtccacccgtagctgctgcgcctgttttcttgcctccacctgccgctgctgctacctccgcaagctttcgccagagctacctgcagatcaacgagcctcgcctgcctactcagccttctcgccagggcggcctccatacccaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

961

Amino Acids

107.02

Weight (kDa)

6.18

Isoelectric Point (pI)

57.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 2788
Acc36I ACCTGC 3 cut(s) 2680, 2788, 2829
AccB1I GGYRCC 1 cut(s) 2140
AccB7I CCANNNNNTGG 2 cut(s) 607, 686
AccBSI CCGCTC 1 cut(s) 1414
AclWI GGATC 2 cut(s) 1800, 1802
AcoI YGGCCR 1 cut(s) 2292
AcsI RAATTY 6 cut(s) 454, 955, 2068, 2161, 2254, 2353
AcuI CTGAAG 2 cut(s) 272, 675
AdeI CACNNNGTG 1 cut(s) 340
AfaI GTAC 2 cut(s) 588, 1057
AfiI CCNNNNNNNGG 8 cut(s) 158, 532, 607, 686, 706, 1475, 2464, 2695
AflIII ACRYGT 2 cut(s) 907, 2322
AhdI GACNNNNNGTC 1 cut(s) 1870
AjiI CACGTC 1 cut(s) 2325
AjnI CCWGG 4 cut(s) 1704, 2551, 2568, 2862
AleI CACNNNNGTG 1 cut(s) 2124
Alw21I GWGCWC 1 cut(s) 1992
Alw26I GTCTC 3 cut(s) 765, 1672, 2637
Alw44I GTGCAC 1 cut(s) 1988
AlwI GGATC 2 cut(s) 1800, 1802
AlwNI CAGNNNCTG 1 cut(s) 866
Ama87I CYCGRG 1 cut(s) 1689
ApaI GGGCCC 1 cut(s) 1483
ApaLI GTGCAC 1 cut(s) 1988
ApoI RAATTY 6 cut(s) 454, 955, 2068, 2161, 2254, 2353
ArsI GACNNNNNNTTYG 4 cut(s) 299, 331, 493, 525
Asp700I GAANNNNTTC 2 cut(s) 2353, 2487
AspLEI GCGC 3 cut(s) 522, 531, 2761
AsuHPI GGTGA 7 cut(s) 362, 463, 686, 738, 2325, 2685, 2702
AsuII TTCGAA 1 cut(s) 1562
AvaI CYCGRG 1 cut(s) 1689
AvaII GGWCC 5 cut(s) 319, 614, 1702, 2129, 2639
BaeGI GKGCMC 3 cut(s) 336, 1483, 1992
BalI TGGCCA 1 cut(s) 2294
BanI GGYRCC 1 cut(s) 2140
BanII GRGCYC 1 cut(s) 1483
BauI CACGAG 2 cut(s) 1640, 1839
BbsI GAAGAC 2 cut(s) 134, 294
Bbv12I GWGCWC 1 cut(s) 1992
BbvCI CCTCAGC 3 cut(s) 91, 1218, 1719
BceAI ACGGC 1 cut(s) 2700
BcgI CGANNNNNNTGC 2 cut(s) 1034, 1068
BciT130I CCWGG 4 cut(s) 1706, 2553, 2570, 2864
BclI TGATCA 1 cut(s) 472
BcoDI GTCTC 3 cut(s) 765, 1672, 2637
BfaI CTAG 4 cut(s) 389, 1034, 1916, 2636
BfmI CTRYAG 4 cut(s) 1297, 2265, 2364, 2822
BfuAI ACCTGC 3 cut(s) 2680, 2788, 2829
BglI GCCNNNNNGGC 1 cut(s) 2868
BglII AGATCT 1 cut(s) 1242
Bme1390I CCNGG 4 cut(s) 1706, 2553, 2570, 2864
Bme18I GGWCC 5 cut(s) 319, 614, 1702, 2129, 2639
BmeRI GACNNNNNGTC 1 cut(s) 1870
BmeT110I CYCGRG 1 cut(s) 1689
BmgBI CACGTC 1 cut(s) 2325
BmrFI CCNGG 4 cut(s) 1706, 2553, 2570, 2864
BmrI ACTGGG 2 cut(s) 2456, 2733
BmsI GCATC 6 cut(s) 365, 928, 1163, 1204, 1395, 2372
BmuI ACTGGG 2 cut(s) 2456, 2733
BpiI GAAGAC 2 cut(s) 134, 294
BpmI CTGGAG 1 cut(s) 1452
Bpu10I CCTNAGC 3 cut(s) 91, 1218, 1719
Bpu14I TTCGAA 1 cut(s) 1562
BpuEI CTTGAG 3 cut(s) 559, 914, 2019
BsaI GGTCTC 1 cut(s) 1672
BsaJI CCNNGG 4 cut(s) 1119, 1515, 2122, 2863
BsaXI ACNNNNNCTCC 4 cut(s) 1735, 1765, 2631, 2661
Bsc4I CCNNNNNNNGG 8 cut(s) 158, 532, 607, 686, 706, 1475, 2464, 2695
Bse118I RCCGGY 3 cut(s) 525, 2695, 2726
Bse1I ACTGG 7 cut(s) 834, 871, 983, 1532, 1682, 2462, 2739
Bse3DI GCAATG 4 cut(s) 973, 1131, 1792, 2576
BseBI CCWGG 4 cut(s) 1706, 2553, 2570, 2864
BseDI CCNNGG 4 cut(s) 1119, 1515, 2122, 2863
BseGI GGATG 6 cut(s) 130, 217, 382, 1194, 1678, 2032
BseLI CCNNNNNNNGG 8 cut(s) 158, 532, 607, 686, 706, 1475, 2464, 2695
BseMI GCAATG 4 cut(s) 973, 1131, 1792, 2576
BseMII CTCAG 7 cut(s) 105, 213, 1209, 1710, 2070, 2238, 2864
BseNI ACTGG 7 cut(s) 834, 871, 983, 1532, 1682, 2462, 2739
BseSI GKGCMC 3 cut(s) 336, 1483, 1992
BseYI CCCAGC 2 cut(s) 398, 2733
BsgI GTGCAG 3 cut(s) 2102, 2658, 2707
BshNI GGYRCC 1 cut(s) 2140
BsiHKAI GWGCWC 1 cut(s) 1992
BsiHKCI CYCGRG 1 cut(s) 1689
BsiSI CCGG 3 cut(s) 526, 2696, 2727
BslFI GGGAC 2 cut(s) 656, 1737
BslI CCNNNNNNNGG 8 cut(s) 158, 532, 607, 686, 706, 1475, 2464, 2695
BsmAI GTCTC 3 cut(s) 765, 1672, 2637
BsmFI GGGAC 2 cut(s) 656, 1737
BsmI GAATGC 2 cut(s) 1381, 1720
Bso31I GGTCTC 1 cut(s) 1672
BsoBI CYCGRG 1 cut(s) 1689
Bsp119I TTCGAA 1 cut(s) 1562
Bsp120I GGGCCC 1 cut(s) 1479
Bsp1286I GDGCHC 3 cut(s) 336, 1483, 1992
Bsp143I GATC 9 cut(s) 58, 472, 1242, 1321, 1632, 1792, 1807, 2096, 2826
Bsp19I CCATGG 1 cut(s) 1119
BspCNI CTCAG 7 cut(s) 104, 214, 1210, 1711, 2071, 2237, 2863
BspHI TCATGA 1 cut(s) 1846
BspMAI CTGCAG 3 cut(s) 2269, 2368, 2826
BspMI ACCTGC 3 cut(s) 2680, 2788, 2829
BspPI GGATC 2 cut(s) 1800, 1802
BspQI GCTCTTC 3 cut(s) 248, 1035, 1386
BspT104I TTCGAA 1 cut(s) 1562
BspT107I GGYRCC 1 cut(s) 2140
BspTNI GGTCTC 1 cut(s) 1672
BsrBI CCGCTC 1 cut(s) 1414
BsrDI GCAATG 4 cut(s) 973, 1131, 1792, 2576
BsrFI RCCGGY 3 cut(s) 525, 2695, 2726
BsrI ACTGG 7 cut(s) 834, 871, 983, 1532, 1682, 2462, 2739
BssAI RCCGGY 3 cut(s) 525, 2695, 2726
BssECI CCNNGG 4 cut(s) 1119, 1515, 2122, 2863
BssMI GATC 9 cut(s) 58, 472, 1242, 1321, 1632, 1792, 1807, 2096, 2826
BssSI CACGAG 2 cut(s) 1640, 1839
BssT1I CCWWGG 2 cut(s) 1119, 1515
Bst2BI CACGAG 2 cut(s) 1640, 1839
Bst2UI CCWGG 4 cut(s) 1706, 2553, 2570, 2864
Bst4CI ACNGT 5 cut(s) 591, 818, 995, 2009, 2111
Bst6I CTCTTC 6 cut(s) 248, 763, 1035, 1140, 1386, 2437
BstBI TTCGAA 1 cut(s) 1562
BstC8I GCNNGC 7 cut(s) 7, 409, 527, 2153, 2518, 2803, 2843
BstDSI CCRYGG 1 cut(s) 1119
BstF5I GGATG 6 cut(s) 130, 217, 382, 1194, 1678, 2032
BstHHI GCGC 3 cut(s) 522, 531, 2761
BstKTI GATC 9 cut(s) 61, 475, 1245, 1324, 1635, 1795, 1810, 2099, 2829
BstMAI GTCTC 3 cut(s) 765, 1672, 2637
BstMBI GATC 9 cut(s) 58, 472, 1242, 1321, 1632, 1792, 1807, 2096, 2826
BstNI CCWGG 4 cut(s) 1706, 2553, 2570, 2864
BstNSI RCATGY 6 cut(s) 9, 911, 1342, 1571, 1579, 2155
BstSCI CCNGG 4 cut(s) 1704, 2551, 2568, 2862
BstSFI CTRYAG 4 cut(s) 1297, 2265, 2364, 2822
BstSLI GKGCMC 3 cut(s) 336, 1483, 1992
BstV2I GAAGAC 2 cut(s) 134, 294
BstX2I RGATCY 2 cut(s) 1242, 1807
BstXI CCANNNNNNTGG 1 cut(s) 329
BstYI RGATCY 2 cut(s) 1242, 1807
BtgI CCRYGG 1 cut(s) 1119
BtrI CACGTC 1 cut(s) 2325
BtsCI GGATG 6 cut(s) 130, 217, 382, 1194, 1678, 2032
BtsIMutI CAGTG 5 cut(s) 40, 864, 1593, 2014, 2469
BveI ACCTGC 3 cut(s) 2680, 2788, 2829
Cac8I GCNNGC 7 cut(s) 7, 409, 527, 2153, 2518, 2803, 2843
CaiI CAGNNNCTG 1 cut(s) 866
CciI TCATGA 1 cut(s) 1846
CfoI GCGC 3 cut(s) 522, 531, 2761
Cfr10I RCCGGY 3 cut(s) 525, 2695, 2726
CseI GACGC 1 cut(s) 1124
Csp6I GTAC 2 cut(s) 587, 1056
CviQI GTAC 2 cut(s) 587, 1056
DpnI GATC 9 cut(s) 60, 474, 1244, 1323, 1634, 1794, 1809, 2098, 2828
DpnII GATC 9 cut(s) 58, 472, 1242, 1321, 1632, 1792, 1807, 2096, 2826
DraIII CACNNNGTG 1 cut(s) 340
DriI GACNNNNNGTC 1 cut(s) 1870
EaeI YGGCCR 1 cut(s) 2292
Eam1104I CTCTTC 6 cut(s) 248, 763, 1035, 1140, 1386, 2437
Eam1105I GACNNNNNGTC 1 cut(s) 1870
EarI CTCTTC 6 cut(s) 248, 763, 1035, 1140, 1386, 2437
Eco130I CCWWGG 2 cut(s) 1119, 1515
Eco24I GRGCYC 1 cut(s) 1483
Eco31I GGTCTC 1 cut(s) 1672
Eco47I GGWCC 5 cut(s) 319, 614, 1702, 2129, 2639
Eco57I CTGAAG 2 cut(s) 272, 675
Eco88I CYCGRG 1 cut(s) 1689
EcoO109I RGGNCCY 4 cut(s) 537, 1479, 1480, 2639
EcoRI GAATTC 3 cut(s) 2068, 2161, 2254
EcoRII CCWGG 4 cut(s) 1704, 2551, 2568, 2862
EcoT14I CCWWGG 2 cut(s) 1119, 1515
EcoT22I ATGCAT 1 cut(s) 1344
EcoT38I GRGCYC 1 cut(s) 1483
ErhI CCWWGG 2 cut(s) 1119, 1515
FalI AAGNNNNNCTT 2 cut(s) 1259, 1291
FaqI GGGAC 2 cut(s) 656, 1737
FauNDI CATATG 1 cut(s) 751
FbaI TGATCA 1 cut(s) 472
FokI GGATG 6 cut(s) 137, 224, 389, 1201, 1685, 2039
FriOI GRGCYC 1 cut(s) 1483
FspBI CTAG 4 cut(s) 389, 1034, 1916, 2636
GlaI GCGC 3 cut(s) 521, 530, 2760
GsaI CCCAGC 2 cut(s) 402, 2737
GsuI CTGGAG 1 cut(s) 1452
HapII CCGG 3 cut(s) 526, 2696, 2727
HgaI GACGC 1 cut(s) 1124
HhaI GCGC 3 cut(s) 522, 531, 2761
Hin6I GCGC 3 cut(s) 520, 529, 2759
HinP1I GCGC 3 cut(s) 520, 529, 2759
HindIII AAGCTT 2 cut(s) 2043, 2803
HinfI GANTC 4 cut(s) 440, 596, 1493, 2533
HpaII CCGG 3 cut(s) 526, 2696, 2727
HphI GGTGA 7 cut(s) 362, 463, 686, 738, 2325, 2685, 2702
Hpy166II GTNNAC 6 cut(s) 1573, 1910, 1990, 2114, 2212, 2744
Hpy8I GTNNAC 6 cut(s) 1573, 1910, 1990, 2114, 2212, 2744
Hpy99I CGWCG 1 cut(s) 2329
HpyCH4III ACNGT 5 cut(s) 591, 818, 995, 2009, 2111
HpyCH4IV ACGT 2 cut(s) 1823, 2324
HpySE526I ACGT 2 cut(s) 1823, 2324
HspAI GCGC 3 cut(s) 520, 529, 2759
KroI GCCGGC 1 cut(s) 525
KroNI GCCGGC 1 cut(s) 527
Ksp22I TGATCA 1 cut(s) 472
Kzo9I GATC 9 cut(s) 58, 472, 1242, 1321, 1632, 1792, 1807, 2096, 2826
LguI GCTCTTC 3 cut(s) 248, 1035, 1386
LmnI GCTCC 2 cut(s) 859, 1411
LweI GCATC 6 cut(s) 365, 928, 1163, 1204, 1395, 2372
MaeI CTAG 4 cut(s) 389, 1034, 1916, 2636
MaeII ACGT 2 cut(s) 1823, 2324
MaeIII GTNAC 3 cut(s) 649, 1490, 1637
MalI GATC 9 cut(s) 60, 474, 1244, 1323, 1634, 1794, 1809, 2098, 2828
MbiI CCGCTC 1 cut(s) 1414
MboI GATC 9 cut(s) 58, 472, 1242, 1321, 1632, 1792, 1807, 2096, 2826
MfeI CAATTG 3 cut(s) 1158, 2175, 2540
MflI RGATCY 2 cut(s) 1242, 1807
MhlI GDGCHC 3 cut(s) 336, 1483, 1992
MlsI TGGCCA 1 cut(s) 2294
MluNI TGGCCA 1 cut(s) 2294
MlyI GAGTC 2 cut(s) 449, 1487
MmeI TCCRAC 2 cut(s) 297, 881
Mox20I TGGCCA 1 cut(s) 2294
Mph1103I ATGCAT 1 cut(s) 1344
MreI CGCCGGCG 1 cut(s) 525
MroNI GCCGGC 1 cut(s) 525
MroXI GAANNNNTTC 2 cut(s) 2353, 2487
MscI TGGCCA 1 cut(s) 2294
MseI TTAA 5 cut(s) 137, 1616, 1820, 1983, 2423
MslI CAYNNNNRTG 5 cut(s) 300, 327, 1124, 1386, 2124
Msp20I TGGCCA 1 cut(s) 2294
MspA1I CMGCKG 3 cut(s) 250, 2494, 2786
MspI CCGG 3 cut(s) 526, 2696, 2727
MspR9I CCNGG 4 cut(s) 1706, 2553, 2570, 2864
MunI CAATTG 3 cut(s) 1158, 2175, 2540
Mva1269I GAATGC 2 cut(s) 1381, 1720
MvaI CCWGG 4 cut(s) 1706, 2553, 2570, 2864
NaeI GCCGGC 1 cut(s) 527
NcoI CCATGG 1 cut(s) 1119
NdeI CATATG 1 cut(s) 751
NdeII GATC 9 cut(s) 58, 472, 1242, 1321, 1632, 1792, 1807, 2096, 2826
NgoMIV GCCGGC 1 cut(s) 525
NmuCI GTSAC 2 cut(s) 1490, 1637
NsiI ATGCAT 1 cut(s) 1344
NspI RCATGY 6 cut(s) 9, 911, 1342, 1571, 1579, 2155
NspV TTCGAA 1 cut(s) 1562
OliI CACNNNNGTG 1 cut(s) 2124
PaeI GCATGC 2 cut(s) 9, 2155
PagI TCATGA 1 cut(s) 1846
PaqCI CACCTGC 1 cut(s) 2788
PciI ACATGT 1 cut(s) 907
PciSI GCTCTTC 3 cut(s) 248, 1035, 1386
PctI GAATGC 2 cut(s) 1381, 1720
PdiI GCCGGC 1 cut(s) 527
PdmI GAANNNNTTC 2 cut(s) 2353, 2487
PfeI GAWTC 2 cut(s) 596, 2533
PflMI CCANNNNNTGG 2 cut(s) 607, 686
PleI GAGTC 2 cut(s) 448, 1487
PpsI GAGTC 2 cut(s) 448, 1487
PpuMI RGGWCCY 1 cut(s) 2639
PscI ACATGT 1 cut(s) 907
Psp5II RGGWCCY 1 cut(s) 2639
Psp6I CCWGG 4 cut(s) 1704, 2551, 2568, 2862
PspFI CCCAGC 2 cut(s) 398, 2733
PspGI CCWGG 4 cut(s) 1704, 2551, 2568, 2862
PspOMI GGGCCC 1 cut(s) 1479
PspPPI RGGWCCY 1 cut(s) 2639
PstI CTGCAG 3 cut(s) 2269, 2368, 2826
PstNI CAGNNNCTG 1 cut(s) 866
PsuI RGATCY 2 cut(s) 1242, 1807
PvuII CAGCTG 2 cut(s) 250, 2494
RsaI GTAC 2 cut(s) 588, 1057
RsaNI GTAC 2 cut(s) 587, 1056
RseI CAYNNNNRTG 5 cut(s) 300, 327, 1124, 1386, 2124
SapI GCTCTTC 3 cut(s) 248, 1035, 1386
SaqAI TTAA 5 cut(s) 137, 1616, 1820, 1983, 2423
Sau3AI GATC 9 cut(s) 58, 472, 1242, 1321, 1632, 1792, 1807, 2096, 2826
SchI GAGTC 2 cut(s) 449, 1487
ScrFI CCNGG 4 cut(s) 1706, 2553, 2570, 2864
SduI GDGCHC 3 cut(s) 336, 1483, 1992
SfaNI GCATC 6 cut(s) 365, 928, 1163, 1204, 1395, 2372
SfcI CTRYAG 4 cut(s) 1297, 2265, 2364, 2822
SfuI TTCGAA 1 cut(s) 1562
SgrAI CRCCGGYG 1 cut(s) 525
SinI GGWCC 5 cut(s) 319, 614, 1702, 2129, 2639
SmiMI CAYNNNNRTG 5 cut(s) 300, 327, 1124, 1386, 2124
SmlI CTYRAG 3 cut(s) 574, 893, 2034
SmoI CTYRAG 3 cut(s) 574, 893, 2034
SphI GCATGC 2 cut(s) 9, 2155
SspMI CTAG 4 cut(s) 389, 1034, 1916, 2636
StyD4I CCNGG 4 cut(s) 1704, 2551, 2568, 2862
StyI CCWWGG 2 cut(s) 1119, 1515
TaaI ACNGT 5 cut(s) 591, 818, 995, 2009, 2111
TaiI ACGT 2 cut(s) 1826, 2327
TaqI TCGA 7 cut(s) 113, 270, 311, 499, 1403, 1562, 2099
TauI GCSGC 7 cut(s) 525, 702, 705, 1109, 2584, 2786, 2871
TfiI GAWTC 2 cut(s) 596, 2533
Tru1I TTAA 5 cut(s) 137, 1616, 1820, 1983, 2423
Tru9I TTAA 5 cut(s) 137, 1616, 1820, 1983, 2423
TscAI CASTG 5 cut(s) 40, 871, 1600, 2014, 2469
TseFI GTSAC 2 cut(s) 1490, 1637
Tsp45I GTSAC 2 cut(s) 1490, 1637
TspGWI ACGGA 2 cut(s) 2246, 2561
TspRI CASTG 5 cut(s) 40, 871, 1600, 2014, 2469
Van91I CCANNNNNTGG 2 cut(s) 607, 686
VneI GTGCAC 1 cut(s) 1988
VpaK11BI GGWCC 5 cut(s) 319, 614, 1702, 2129, 2639
XapI RAATTY 6 cut(s) 454, 955, 2068, 2161, 2254, 2353
XceI RCATGY 6 cut(s) 9, 911, 1342, 1571, 1579, 2155
XcmI CCANNNNNNNNNTGG 2 cut(s) 608, 2461
XmnI GAANNNNTTC 2 cut(s) 2353, 2487
XspI CTAG 4 cut(s) 389, 1034, 1916, 2636
Zsp2I ATGCAT 1 cut(s) 1344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.