Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0030201.1

Orthogroup ID

OG0005702

Physical Location & Seq

Genomic Coordinates Forward (+)

157 .. 1500

Gene Structure 1344 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0030201.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 588 bp

atgttggactctctctatctgcttgcatcagattatgctgtaaaagagaagcctcagctggtcgacgatatgcagggtgggccagactacatagttcttagaactttggacacggatagtatccgcattattggaagtgtgcttggccaaagtattgctttagattattttgtttcgcaggttgatggtatggttgaagagtttgcagatataaatcgaggaatggaaaaaactggaacttttaccatgcataaaaagaagctccttcaactcgttggaaaggctaactcaactctagctgatgtaattgtcaaagttggtctatttgagagatcagaaattgcttggagggatgcaaagtatgctaaaatacatgaatacctgagggaggagtatgaggttacgcagcgatttggaaacttggatttcaagttaaaatttgtagagcacaacattcatttcttgcaagaagtcctacaaaacagaaagtctgatcttctggaatggtgcatcatcttcctgttgactgtagagaatattatatcactatacgagattgttcgtgattcaggtgcagtttctgggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF155

Protein Analysis

195

Amino Acids

22.31

Weight (kDa)

5.05

Isoelectric Point (pI)

32.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005702)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G69380
fragaria_vesca	FvH4_4g30570 FvH4_4g30570 FvH4_4g30570 FvH4_4g30570 FvH4_4g30570
malus_domestica	MD13G1066700.v1.1 MD16G1065900.v1.1
prunus_persica	Prupe.1G281200_v2.0.a1 Prupe.1G281200_v2.0.a1 Prupe.1G281200_v2.0.a1 Prupe.1G281200_v2.0.a1
pyrus_communis	pycom13g05900 pycom16g05750
rosa_chinensis	RchiOBHm_Chr4g0438971
rosa_laevigata	RLG00000006314
rosa_multiflora	Rmu_sc0005887.1_g000006 Rmu_sc0023005.1_g000004 Rmu_sc0023254.1_g000002 Rmu_sc0030201.1_g000001
rosa_roxburghii	Rroxscaffold_5G00379980
rosa_rugosa	Rorug04G0314800
rosa_samantha	Rh4AG365400 Rh4BG376600 Rh4CG390700 Rh4DG371300
rosa_wichuraiana	Rw0G007370 Rw0G016920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	169
AccI	GTMKAC	1 cut(s)	63
AciI	CCGC	1 cut(s)	124
AcoI	YGGCCR	1 cut(s)	145
AcsI	RAATTY	1 cut(s)	437
AfiI	CCNNNNNNNGG	1 cut(s)	388
AgsI	TTSAA	3 cut(s)	197, 269, 430
AluBI	AGCT	3 cut(s)	58, 262, 299
AluI	AGCT	3 cut(s)	58, 262, 299
Alw21I	GWGCWC	1 cut(s)	450
AlwNI	CAGNNNCTG	1 cut(s)	581
AoxI	GGCC	2 cut(s)	80, 145
ApeKI	GCWGC	1 cut(s)	406
ApoI	RAATTY	1 cut(s)	437
AspS9I	GGNCC	1 cut(s)	80
AxyI	CCTNAGG	1 cut(s)	383
BalI	TGGCCA	1 cut(s)	147
Bbv12I	GWGCWC	1 cut(s)	450
BbvCI	CCTCAGC	1 cut(s)	54
BbvI	GCAGC	1 cut(s)	418
BccI	CCATC	1 cut(s)	179
BciVI	GTATCC	1 cut(s)	131
BfaI	CTAG	1 cut(s)	296
BfmI	CTRYAG	1 cut(s)	528
BfuAI	ACCTGC	1 cut(s)	169
BfuI	GTATCC	1 cut(s)	131
BisI	GCNGC	1 cut(s)	407
BlsI	GCNGC	1 cut(s)	408
BmgT120I	GGNCC	1 cut(s)	80
BmsI	GCATC	3 cut(s)	35, 343, 519
Bpu10I	CCTNAGC	1 cut(s)	54
BsaBI	GATNNNNATC	1 cut(s)	213
Bsc4I	CCNNNNNNNGG	1 cut(s)	388
Bse1I	ACTGG	1 cut(s)	238
Bse21I	CCTNAGG	1 cut(s)	383
Bse8I	GATNNNNATC	1 cut(s)	213
BseGI	GGATG	1 cut(s)	358
BseJI	GATNNNNATC	1 cut(s)	213
BseLI	CCNNNNNNNGG	1 cut(s)	388
BseMII	CTCAG	2 cut(s)	68, 374
BseNI	ACTGG	1 cut(s)	238
BseRI	GAGGAG	1 cut(s)	404
BseXI	GCAGC	1 cut(s)	418
BshFI	GGCC	2 cut(s)	82, 147
BsiHKAI	GWGCWC	1 cut(s)	450
BslI	CCNNNNNNNGG	1 cut(s)	388
BsnI	GGCC	2 cut(s)	82, 147
Bsp1286I	GDGCHC	1 cut(s)	450
Bsp143I	GATC	2 cut(s)	332, 493
BspACI	CCGC	1 cut(s)	124
BspANI	GGCC	2 cut(s)	82, 147
BspCNI	CTCAG	2 cut(s)	67, 375
BspMI	ACCTGC	1 cut(s)	169
BsrI	ACTGG	1 cut(s)	238
BssMI	GATC	2 cut(s)	332, 493
Bst4CI	ACNGT	1 cut(s)	529
Bst6I	CTCTTC	1 cut(s)	192
BstAPI	GCANNNNNTGC	1 cut(s)	362
BstC8I	GCNNGC	1 cut(s)	24
BstDEI	CTNAG	3 cut(s)	54, 98, 383
BstENI	CCTNNNNNAGG	1 cut(s)	386
BstF5I	GGATG	1 cut(s)	358
BstKTI	GATC	2 cut(s)	335, 496
BstMBI	GATC	2 cut(s)	332, 493
BstMWI	GCNNNNNNNGC	2 cut(s)	79, 362
BstSFI	CTRYAG	1 cut(s)	528
BstV1I	GCAGC	1 cut(s)	418
Bsu36I	CCTNAGG	1 cut(s)	383
BsuI	GTATCC	1 cut(s)	131
BsuRI	GGCC	2 cut(s)	82, 147
BtsCI	GGATG	1 cut(s)	358
BveI	ACCTGC	1 cut(s)	169
Cac8I	GCNNGC	1 cut(s)	24
CaiI	CAGNNNCTG	1 cut(s)	581
Cfr13I	GGNCC	1 cut(s)	80
CviAII	CATG	2 cut(s)	247, 374
CviJI	RGCY	7 cut(s)	52, 58, 82, 147, 262, 284, 299
CviKI_1	RGCY	7 cut(s)	52, 58, 82, 147, 262, 284, 299
DdeI	CTNAG	3 cut(s)	54, 98, 383
DpnI	GATC	2 cut(s)	334, 495
DpnII	GATC	2 cut(s)	332, 493
EaeI	YGGCCR	1 cut(s)	145
Eam1104I	CTCTTC	1 cut(s)	192
EarI	CTCTTC	1 cut(s)	192
Eco81I	CCTNAGG	1 cut(s)	383
EcoNI	CCTNNNNNAGG	1 cut(s)	386
EcoT22I	ATGCAT	1 cut(s)	252
FaeI	CATG	2 cut(s)	250, 377
FalI	AAGNNNNNCTT	2 cut(s)	142, 174
FatI	CATG	2 cut(s)	246, 373
FblI	GTMKAC	1 cut(s)	63
Fnu4HI	GCNGC	1 cut(s)	407
FokI	GGATG	1 cut(s)	365
Fsp4HI	GCNGC	1 cut(s)	407
FspBI	CTAG	1 cut(s)	296
GluI	GCNGC	1 cut(s)	407
HaeIII	GGCC	2 cut(s)	82, 147
Hin1II	CATG	2 cut(s)	250, 377
HincII	GTYRAC	2 cut(s)	64, 525
HindII	GTYRAC	2 cut(s)	64, 525
HinfI	GANTC	2 cut(s)	8, 566
Hpy166II	GTNNAC	2 cut(s)	64, 525
Hpy188I	TCNGA	3 cut(s)	31, 337, 493
Hpy188III	TCNNGA	2 cut(s)	500, 563
Hpy8I	GTNNAC	2 cut(s)	64, 525
Hpy99I	CGWCG	1 cut(s)	68
HpyAV	CCTTC	1 cut(s)	275
HpyCH4III	ACNGT	1 cut(s)	529
HpyCH4V	TGCA	8 cut(s)	26, 73, 206, 250, 356, 466, 510, 575
HpyF10VI	GCNNNNNNNGC	2 cut(s)	79, 362
HpyF3I	CTNAG	3 cut(s)	54, 98, 383
Hsp92II	CATG	2 cut(s)	250, 377
Kzo9I	GATC	2 cut(s)	332, 493
LmnI	GCTCC	1 cut(s)	267
Lsp1109I	GCAGC	1 cut(s)	418
LweI	GCATC	3 cut(s)	35, 343, 519
MaeI	CTAG	1 cut(s)	296
MaeIII	GTNAC	1 cut(s)	400
MalI	GATC	2 cut(s)	334, 495
MboI	GATC	2 cut(s)	332, 493
MboII	GAAGA	3 cut(s)	209, 488, 508
MhlI	GDGCHC	1 cut(s)	450
MlsI	TGGCCA	1 cut(s)	147
MluCI	AATT	3 cut(s)	306, 339, 437
MluNI	TGGCCA	1 cut(s)	147
MlyI	GAGTC	1 cut(s)	2
MmeI	TCCRAC	1 cut(s)	256
MnlI	CCTC	6 cut(s)	63, 212, 342, 378, 382, 391
Mox20I	TGGCCA	1 cut(s)	147
Mph1103I	ATGCAT	1 cut(s)	252
MscI	TGGCCA	1 cut(s)	147
MseI	TTAA	1 cut(s)	434
Msp20I	TGGCCA	1 cut(s)	147
MspA1I	CMGCKG	1 cut(s)	58
MwoI	GCNNNNNNNGC	2 cut(s)	79, 362
NdeII	GATC	2 cut(s)	332, 493
NlaIII	CATG	2 cut(s)	250, 377
NsiI	ATGCAT	1 cut(s)	252
PfeI	GAWTC	1 cut(s)	566
PkrI	GCNGC	1 cut(s)	408
PleI	GAGTC	1 cut(s)	2
PpsI	GAGTC	1 cut(s)	2
PspPI	GGNCC	1 cut(s)	80
PstNI	CAGNNNCTG	1 cut(s)	581
PvuII	CAGCTG	1 cut(s)	58
SalI	GTCGAC	1 cut(s)	62
SaqAI	TTAA	1 cut(s)	434
SatI	GCNGC	1 cut(s)	407
Sau3AI	GATC	2 cut(s)	332, 493
Sau96I	GGNCC	1 cut(s)	80
SchI	GAGTC	1 cut(s)	2
SduI	GDGCHC	1 cut(s)	450
SetI	ASST	7 cut(s)	60, 183, 264, 301, 384, 402, 574
SfaNI	GCATC	3 cut(s)	35, 343, 519
SfcI	CTRYAG	1 cut(s)	528
Sse9I	AATT	3 cut(s)	306, 339, 437
SsiI	CCGC	1 cut(s)	124
SspI	AATATT	1 cut(s)	538
SspMI	CTAG	1 cut(s)	296
TaaI	ACNGT	1 cut(s)	529
TaqI	TCGA	2 cut(s)	63, 217
TasI	AATT	3 cut(s)	306, 339, 437
TfiI	GAWTC	1 cut(s)	566
Tru1I	TTAA	1 cut(s)	434
Tru9I	TTAA	1 cut(s)	434
TseI	GCWGC	1 cut(s)	406
TspDTI	ATGAA	2 cut(s)	390, 446
TspGWI	ACGGA	1 cut(s)	128
XagI	CCTNNNNNAGG	1 cut(s)	386
XapI	RAATTY	1 cut(s)	437
XmiI	GTMKAC	1 cut(s)	63
XspI	CTAG	1 cut(s)	296
Zsp2I	ATGCAT	1 cut(s)	252

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.