Rmu_sc0030312.1_g000001

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030312.1
Physical Location & Seq
Forward (+)
433 .. 1137
705 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030312.1_g000001.1.cds

Sequence Viewer

Length: 705 bp
atggtgaagacagagcagaggattcagctggcttctgagacctcattgaaaccattaatgccttcgtcgaaaacaacatcgagggacaagaagaagaagtacaagggtgtgaggatgaggagctggggctcatgggtttcggagattagagccccaaaccagaagacaagaatatggctaggctcatactcaacagcggaagcagcagccagagcctatgatgccgctctcttgtgcctcaaaggctcctcagccaatctcaacttcccaatcagtgcctcctcacagtttgttcctcatgaaaatactatcatgtccccgaagtccattcagagagtagctgcagctgctgctaatagcttcaatcatgaaaatgccaccaccatcacagcctcatctccaccatcaccggctcctaatgatctctcttcttcatcttcatcactggtctcatccccatcaatgtcatcatcctcaccgtcgattaatctcgttgacgatgacatgtcctcgctgatgggatcatttgggtcctatactcctactacttatgatcataatccacaggcggactatgatgtaccaatctgcaccatggaatcatggaacaactttgatgatttattcactggtgccttgttggatccaccaatgaattatgacttctatgaagaaagcgatattcgcttgtggagcttctgctga

Protein Analysis

234

Amino Acids

25.63

Weight (kDa)

5.62

Isoelectric Point (pI)

62.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 632
AccBSI CCGCTC 1 cut(s) 227
AciI CCGC 3 cut(s) 197, 225, 569
AclWI GGATC 3 cut(s) 529, 638, 651
AfaI GTAC 2 cut(s) 101, 582
AflIII ACRYGT 1 cut(s) 504
AgsI TTSAA 2 cut(s) 49, 364
AjuI GAANNNNNNNTTGG 2 cut(s) 248, 280
AluBI AGCT 6 cut(s) 28, 123, 341, 347, 360, 696
AluI AGCT 6 cut(s) 28, 123, 341, 347, 360, 696
Alw26I GTCTC 2 cut(s) 32, 454
AlwI GGATC 3 cut(s) 529, 638, 651
AlwNI CAGNNNCTG 1 cut(s) 350
ApeKI GCWGC 6 cut(s) 203, 206, 341, 344, 347, 350
AseI ATTAAT 2 cut(s) 56, 486
AspS9I GGNCC 1 cut(s) 531
AsuHPI GGTGA 3 cut(s) 16, 399, 468
AvaII GGWCC 1 cut(s) 531
BamHI GGATCC 1 cut(s) 643
BanI GGYRCC 1 cut(s) 632
BanII GRGCYC 2 cut(s) 131, 154
BarI GAAGNNNNNNTAC 2 cut(s) 83, 115
BbsI GAAGAC 2 cut(s) 14, 170
BbvCI CCTCAGC 1 cut(s) 250
BbvI GCAGC 6 cut(s) 215, 218, 328, 334, 337, 356
BccI CCATC 4 cut(s) 392, 412, 466, 511
BclI TGATCA 1 cut(s) 553
BcoDI GTCTC 2 cut(s) 32, 454
BfaI CTAG 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 342
BglI GCCNNNNNGGC 1 cut(s) 243
BisI GCNGC 7 cut(s) 204, 207, 225, 342, 345, 348, 351
BlsI GCNGC 7 cut(s) 205, 208, 226, 343, 346, 349, 352
Bme18I GGWCC 1 cut(s) 531
BmgT120I GGNCC 1 cut(s) 531
BmiI GGNNCC 5 cut(s) 247, 414, 532, 634, 645
BmsI GCATC 1 cut(s) 211
BpiI GAAGAC 2 cut(s) 14, 170
Bpu10I CCTNAGC 1 cut(s) 250
BsaBI GATNNNNATC 1 cut(s) 558
BsaI GGTCTC 2 cut(s) 32, 454
BsaJI CCNNGG 1 cut(s) 594
Bse118I RCCGGY 1 cut(s) 409
Bse1I ACTGG 2 cut(s) 450, 634
Bse8I GATNNNNATC 1 cut(s) 558
BseDI CCNNGG 1 cut(s) 594
BseGI GGATG 3 cut(s) 120, 452, 470
BseJI GATNNNNATC 1 cut(s) 558
BseMII CTCAG 2 cut(s) 27, 264
BseNI ACTGG 2 cut(s) 450, 634
BseRI GAGGAG 3 cut(s) 133, 238, 271
BseXI GCAGC 6 cut(s) 215, 218, 328, 334, 337, 356
BseYI CCCAGC 1 cut(s) 123
BsgI GTGCAG 1 cut(s) 574
BshNI GGYRCC 1 cut(s) 632
BsiSI CCGG 1 cut(s) 410
BslFI GGGAC 2 cut(s) 98, 301
BsmAI GTCTC 2 cut(s) 32, 454
BsmFI GGGAC 2 cut(s) 98, 301
Bso31I GGTCTC 2 cut(s) 32, 454
Bsp1286I GDGCHC 2 cut(s) 131, 154
Bsp143I GATC 4 cut(s) 421, 521, 553, 643
Bsp19I CCATGG 1 cut(s) 594
BspACI CCGC 3 cut(s) 197, 225, 569
BspCNI CTCAG 2 cut(s) 28, 263
BspHI TCATGA 2 cut(s) 298, 367
BspLI GGNNCC 5 cut(s) 247, 414, 532, 634, 645
BspMAI CTGCAG 1 cut(s) 346
BspPI GGATC 3 cut(s) 529, 638, 651
BspT107I GGYRCC 1 cut(s) 632
BspTNI GGTCTC 2 cut(s) 32, 454
BsrBI CCGCTC 1 cut(s) 227
BsrFI RCCGGY 1 cut(s) 409
BsrI ACTGG 2 cut(s) 450, 634
BssAI RCCGGY 1 cut(s) 409
BssECI CCNNGG 1 cut(s) 594
BssMI GATC 4 cut(s) 421, 521, 553, 643
BssT1I CCWWGG 1 cut(s) 594
Bst4CI ACNGT 2 cut(s) 288, 480
Bst6I CTCTTC 1 cut(s) 433
BstAPI GCANNNNNTGC 1 cut(s) 350
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 2 cut(s) 36, 250
BstDSI CCRYGG 1 cut(s) 594
BstF5I GGATG 3 cut(s) 120, 452, 470
BstKTI GATC 4 cut(s) 424, 524, 556, 646
BstMAI GTCTC 2 cut(s) 32, 454
BstMBI GATC 4 cut(s) 421, 521, 553, 643
BstMWI GCNNNNNNNGC 8 cut(s) 203, 212, 221, 243, 347, 350, 684, 693
BstNSI RCATGY 1 cut(s) 508
BstSFI CTRYAG 1 cut(s) 342
BstV1I GCAGC 6 cut(s) 215, 218, 328, 334, 337, 356
BstV2I GAAGAC 2 cut(s) 14, 170
BstX2I RGATCY 1 cut(s) 643
BstYI RGATCY 1 cut(s) 643
BtgI CCRYGG 1 cut(s) 594
BtsCI GGATG 3 cut(s) 120, 452, 470
BtsIMutI CAGTG 3 cut(s) 280, 443, 627
Cac8I GCNNGC 1 cut(s) 30
CaiI CAGNNNCTG 1 cut(s) 350
CciI TCATGA 2 cut(s) 298, 367
Cfr10I RCCGGY 1 cut(s) 409
Cfr13I GGNCC 1 cut(s) 531
Csp6I GTAC 2 cut(s) 100, 581
CviAII CATG 7 cut(s) 132, 299, 313, 368, 505, 595, 603
CviQI GTAC 2 cut(s) 100, 581
DdeI CTNAG 2 cut(s) 36, 250
DpnI GATC 4 cut(s) 423, 523, 555, 645
DpnII GATC 4 cut(s) 421, 521, 553, 643
Eam1104I CTCTTC 1 cut(s) 433
EarI CTCTTC 1 cut(s) 433
EciI GGCGGA 1 cut(s) 584
Eco130I CCWWGG 1 cut(s) 594
Eco24I GRGCYC 2 cut(s) 131, 154
Eco31I GGTCTC 2 cut(s) 32, 454
Eco47I GGWCC 1 cut(s) 531
EcoO109I RGGNCCY 1 cut(s) 531
EcoT14I CCWWGG 1 cut(s) 594
EcoT38I GRGCYC 2 cut(s) 131, 154
ErhI CCWWGG 1 cut(s) 594
FaeI CATG 7 cut(s) 135, 302, 316, 371, 508, 598, 606
FaqI GGGAC 2 cut(s) 98, 301
FatI CATG 7 cut(s) 131, 298, 312, 367, 504, 594, 602
FbaI TGATCA 1 cut(s) 553
Fnu4HI GCNGC 7 cut(s) 204, 207, 225, 342, 345, 348, 351
FokI GGATG 3 cut(s) 127, 439, 457
FriOI GRGCYC 2 cut(s) 131, 154
Fsp4HI GCNGC 7 cut(s) 204, 207, 225, 342, 345, 348, 351
FspBI CTAG 1 cut(s) 179
GluI GCNGC 7 cut(s) 204, 207, 225, 342, 345, 348, 351
GsaI CCCAGC 1 cut(s) 127
HapII CCGG 1 cut(s) 410
Hin1II CATG 7 cut(s) 135, 302, 316, 371, 508, 598, 606
HincII GTYRAC 1 cut(s) 496
HindII GTYRAC 1 cut(s) 496
HinfI GANTC 2 cut(s) 22, 599
HpaII CCGG 1 cut(s) 410
HphI GGTGA 3 cut(s) 16, 399, 468
Hpy166II GTNNAC 1 cut(s) 496
Hpy188I TCNGA 3 cut(s) 37, 142, 333
Hpy188III TCNNGA 2 cut(s) 299, 368
Hpy8I GTNNAC 1 cut(s) 496
Hpy99I CGWCG 2 cut(s) 70, 484
HpyAV CCTTC 1 cut(s) 72
HpyCH4III ACNGT 2 cut(s) 288, 480
HpyCH4V TGCA 2 cut(s) 344, 591
HpyF10VI GCNNNNNNNGC 8 cut(s) 203, 212, 221, 243, 347, 350, 684, 693
HpyF3I CTNAG 2 cut(s) 36, 250
Hsp92II CATG 7 cut(s) 135, 302, 316, 371, 508, 598, 606
Ksp22I TGATCA 1 cut(s) 553
Kzo9I GATC 4 cut(s) 421, 521, 553, 643
LmnI GCTCC 4 cut(s) 120, 251, 418, 693
LpnPI CCDG 8 cut(s) 14, 109, 173, 223, 423, 431, 551, 615
Lsp1109I GCAGC 6 cut(s) 215, 218, 328, 334, 337, 356
LweI GCATC 1 cut(s) 211
MaeI CTAG 1 cut(s) 179
MalI GATC 4 cut(s) 423, 523, 555, 645
MbiI CCGCTC 1 cut(s) 227
MboI GATC 4 cut(s) 421, 521, 553, 643
MboII GAAGA 8 cut(s) 19, 103, 106, 175, 420, 423, 429, 683
MflI RGATCY 1 cut(s) 643
MhlI GDGCHC 2 cut(s) 131, 154
MluCI AATT 1 cut(s) 655
MmeI TCCRAC 1 cut(s) 621
MseI TTAA 2 cut(s) 56, 486
MslI CAYNNNNRTG 1 cut(s) 372
MspA1I CMGCKG 3 cut(s) 28, 197, 347
MspI CCGG 1 cut(s) 410
MwoI GCNNNNNNNGC 8 cut(s) 203, 212, 221, 243, 347, 350, 684, 693
NcoI CCATGG 1 cut(s) 594
NdeII GATC 4 cut(s) 421, 521, 553, 643
NlaIII CATG 7 cut(s) 135, 302, 316, 371, 508, 598, 606
NlaIV GGNNCC 5 cut(s) 247, 414, 532, 634, 645
NspI RCATGY 1 cut(s) 508
PagI TCATGA 2 cut(s) 298, 367
PciI ACATGT 1 cut(s) 504
PfeI GAWTC 2 cut(s) 22, 599
PkrI GCNGC 7 cut(s) 205, 208, 226, 343, 346, 349, 352
PpuMI RGGWCCY 1 cut(s) 531
PscI ACATGT 1 cut(s) 504
PshBI ATTAAT 2 cut(s) 56, 486
Psp5II RGGWCCY 1 cut(s) 531
PspFI CCCAGC 1 cut(s) 123
PspN4I GGNNCC 5 cut(s) 247, 414, 532, 634, 645
PspPI GGNCC 1 cut(s) 531
PspPPI RGGWCCY 1 cut(s) 531
PstI CTGCAG 1 cut(s) 346
PstNI CAGNNNCTG 1 cut(s) 350
PsuI RGATCY 1 cut(s) 643
PvuII CAGCTG 2 cut(s) 28, 347
RsaI GTAC 2 cut(s) 101, 582
RsaNI GTAC 2 cut(s) 100, 581
RseI CAYNNNNRTG 1 cut(s) 372
SaqAI TTAA 2 cut(s) 56, 486
SatI GCNGC 7 cut(s) 204, 207, 225, 342, 345, 348, 351
Sau3AI GATC 4 cut(s) 421, 521, 553, 643
Sau96I GGNCC 1 cut(s) 531
SduI GDGCHC 2 cut(s) 131, 154
SetI ASST 7 cut(s) 30, 44, 125, 343, 349, 362, 698
SfaNI GCATC 1 cut(s) 211
SfcI CTRYAG 1 cut(s) 342
SinI GGWCC 1 cut(s) 531
SmiMI CAYNNNNRTG 1 cut(s) 372
Sse9I AATT 1 cut(s) 655
SsiI CCGC 3 cut(s) 197, 225, 569
SspMI CTAG 1 cut(s) 179
StyI CCWWGG 1 cut(s) 594
TaaI ACNGT 2 cut(s) 288, 480
TaqI TCGA 3 cut(s) 68, 80, 482
TasI AATT 1 cut(s) 655
TatI WGTACW 1 cut(s) 99
TauI GCSGC 1 cut(s) 227
TfiI GAWTC 2 cut(s) 22, 599
Tru1I TTAA 2 cut(s) 56, 486
Tru9I TTAA 2 cut(s) 56, 486
TscAI CASTG 3 cut(s) 280, 450, 634
TseI GCWGC 6 cut(s) 203, 206, 341, 344, 347, 350
TspDTI ATGAA 6 cut(s) 315, 384, 423, 429, 668, 684
TspRI CASTG 3 cut(s) 280, 450, 634
VpaK11BI GGWCC 1 cut(s) 531
VspI ATTAAT 2 cut(s) 56, 486
XceI RCATGY 1 cut(s) 508
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.