Rh6BG372800

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
60199986 .. 60200186
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG372800.1

Sequence Viewer

Length: 201 bp
ATGTCCTCGCTGATGGGCTCATTTGGGTCCTATACTCCTACTACTTATGATCATAATCCACAGGCGGACTATGATGTACCAATCTGCACCATGGAATCATGGAACAACTTTGATGATTTATTCACTGGTGCCTTGTTGGATCCACCTATGAATTATGACTTCTATGAAGAAAGCGATATTCGCTTGTGGAGCTTCTGCTGA

Protein Analysis

66

Amino Acids

7.66

Weight (kDa)

4.05

Isoelectric Point (pI)

59.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 128
AciI CCGC 1 cut(s) 65
AclWI GGATC 2 cut(s) 134, 147
AfaI GTAC 1 cut(s) 78
AluBI AGCT 1 cut(s) 192
AluI AGCT 1 cut(s) 192
AlwI GGATC 2 cut(s) 134, 147
AspS9I GGNCC 1 cut(s) 27
AvaII GGWCC 1 cut(s) 27
BamHI GGATCC 1 cut(s) 139
BanI GGYRCC 1 cut(s) 128
BanII GRGCYC 1 cut(s) 20
BccI CCATC 1 cut(s) 7
BclI TGATCA 1 cut(s) 49
Bme18I GGWCC 1 cut(s) 27
BmgT120I GGNCC 1 cut(s) 27
BmiI GGNNCC 3 cut(s) 28, 130, 141
BsaBI GATNNNNATC 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 130
Bse8I GATNNNNATC 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 90
BseJI GATNNNNATC 1 cut(s) 54
BseNI ACTGG 1 cut(s) 130
BsgI GTGCAG 1 cut(s) 70
BshNI GGYRCC 1 cut(s) 128
Bsp1286I GDGCHC 1 cut(s) 20
Bsp143I GATC 2 cut(s) 49, 139
Bsp19I CCATGG 1 cut(s) 90
BspACI CCGC 1 cut(s) 65
BspLI GGNNCC 3 cut(s) 28, 130, 141
BspPI GGATC 2 cut(s) 134, 147
BspT107I GGYRCC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 130
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 2 cut(s) 49, 139
BssT1I CCWWGG 1 cut(s) 90
BstDSI CCRYGG 1 cut(s) 90
BstKTI GATC 2 cut(s) 52, 142
BstMBI GATC 2 cut(s) 49, 139
BstMWI GCNNNNNNNGC 2 cut(s) 180, 189
BstX2I RGATCY 1 cut(s) 139
BstYI RGATCY 1 cut(s) 139
BtgI CCRYGG 1 cut(s) 90
BtsIMutI CAGTG 1 cut(s) 123
Cfr13I GGNCC 1 cut(s) 27
Csp6I GTAC 1 cut(s) 77
CviAII CATG 2 cut(s) 91, 99
CviJI RGCY 2 cut(s) 18, 192
CviKI_1 RGCY 2 cut(s) 18, 192
CviQI GTAC 1 cut(s) 77
DpnI GATC 2 cut(s) 51, 141
DpnII GATC 2 cut(s) 49, 139
EciI GGCGGA 1 cut(s) 80
Eco130I CCWWGG 1 cut(s) 90
Eco24I GRGCYC 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 27
EcoO109I RGGNCCY 1 cut(s) 27
EcoT14I CCWWGG 1 cut(s) 90
EcoT38I GRGCYC 1 cut(s) 20
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 2 cut(s) 94, 102
FaiI YATR 9 cut(s) 33, 48, 54, 72, 92, 100, 149, 156, 165
FatI CATG 2 cut(s) 90, 98
FbaI TGATCA 1 cut(s) 49
FriOI GRGCYC 1 cut(s) 20
Hin1II CATG 2 cut(s) 94, 102
HinfI GANTC 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 87
HpyF10VI GCNNNNNNNGC 2 cut(s) 180, 189
Hsp92II CATG 2 cut(s) 94, 102
Ksp22I TGATCA 1 cut(s) 49
Kzo9I GATC 2 cut(s) 49, 139
LmnI GCTCC 1 cut(s) 189
LpnPI CCDG 2 cut(s) 47, 111
MalI GATC 2 cut(s) 51, 141
MboI GATC 2 cut(s) 49, 139
MboII GAAGA 1 cut(s) 179
MflI RGATCY 1 cut(s) 139
MhlI GDGCHC 1 cut(s) 20
MluCI AATT 1 cut(s) 151
MmeI TCCRAC 1 cut(s) 117
MnlI CCTC 1 cut(s) 16
MwoI GCNNNNNNNGC 2 cut(s) 180, 189
NcoI CCATGG 1 cut(s) 90
NdeII GATC 2 cut(s) 49, 139
NlaIII CATG 2 cut(s) 94, 102
NlaIV GGNNCC 3 cut(s) 28, 130, 141
PfeI GAWTC 1 cut(s) 95
PpuMI RGGWCCY 1 cut(s) 27
Psp5II RGGWCCY 1 cut(s) 27
PspN4I GGNNCC 3 cut(s) 28, 130, 141
PspPI GGNCC 1 cut(s) 27
PspPPI RGGWCCY 1 cut(s) 27
PsuI RGATCY 1 cut(s) 139
RsaI GTAC 1 cut(s) 78
RsaNI GTAC 1 cut(s) 77
Sau3AI GATC 2 cut(s) 49, 139
Sau96I GGNCC 1 cut(s) 27
SduI GDGCHC 1 cut(s) 20
SetI ASST 2 cut(s) 148, 194
SgeI CNNG 7 cut(s) 19, 74, 103, 111, 138, 145, 196
SinI GGWCC 1 cut(s) 27
Sse9I AATT 1 cut(s) 151
SsiI CCGC 1 cut(s) 65
StyI CCWWGG 1 cut(s) 90
TasI AATT 1 cut(s) 151
TfiI GAWTC 1 cut(s) 95
TscAI CASTG 1 cut(s) 130
TspDTI ATGAA 2 cut(s) 164, 180
TspRI CASTG 1 cut(s) 130
VpaK11BI GGWCC 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.