Rmu_sc0038779.1_g000001

Oxidation resistance protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0038779.1
Physical Location & Seq
Reverse (-)
1 .. 817
817 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0038779.1_g000001.1.cds

Sequence Viewer

Length: 219 bp
acaaggtgctgtgtttggtggactcctagagggccccttgaaaccaacggcaaagagaaaatatcaaggaacgaaccaggcatttgttttcactaccagatatggtcagccaaggctatttagaccaactggagccaatcgttactattacatgtgtttgaatgatctgcttgcttttgggggtggcggtaactttgctttatgcttagatggagatct
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.0

Weight (kDa)

9.39

Isoelectric Point (pI)

23.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 187
AflIII ACRYGT 1 cut(s) 151
AgsI TTSAA 2 cut(s) 41, 161
AjnI CCWGG 1 cut(s) 76
AoxI GGCC 1 cut(s) 32
ApaI GGGCCC 1 cut(s) 36
AspS9I GGNCC 2 cut(s) 32, 33
BaeGI GKGCMC 1 cut(s) 36
BanII GRGCYC 1 cut(s) 36
BccI CCATC 1 cut(s) 204
BceAI ACGGC 1 cut(s) 64
BciT130I CCWGG 1 cut(s) 78
BfaI CTAG 1 cut(s) 27
BglII AGATCT 1 cut(s) 215
Bme1390I CCNGG 1 cut(s) 78
BmgT120I GGNCC 2 cut(s) 32, 33
BmiI GGNNCC 3 cut(s) 34, 35, 134
BmrFI CCNGG 1 cut(s) 78
BpmI CTGGAG 1 cut(s) 151
BsaBI GATNNNNATC 1 cut(s) 214
BsaJI CCNNGG 1 cut(s) 111
Bse1I ACTGG 1 cut(s) 134
Bse8I GATNNNNATC 1 cut(s) 214
BseBI CCWGG 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 111
BseJI GATNNNNATC 1 cut(s) 214
BseNI ACTGG 1 cut(s) 134
BseSI GKGCMC 1 cut(s) 36
BshFI GGCC 1 cut(s) 34
BsnI GGCC 1 cut(s) 34
Bsp120I GGGCCC 1 cut(s) 32
Bsp1286I GDGCHC 1 cut(s) 36
Bsp143I GATC 2 cut(s) 164, 215
BspACI CCGC 1 cut(s) 187
BspANI GGCC 1 cut(s) 34
BspLI GGNNCC 3 cut(s) 34, 35, 134
BsrI ACTGG 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 2 cut(s) 164, 215
BssT1I CCWWGG 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 172
BstDEI CTNAG 1 cut(s) 206
BstKTI GATC 2 cut(s) 167, 218
BstMBI GATC 2 cut(s) 164, 215
BstNI CCWGG 1 cut(s) 78
BstNSI RCATGY 1 cut(s) 155
BstSCI CCNGG 1 cut(s) 76
BstSLI GKGCMC 1 cut(s) 36
BstX2I RGATCY 1 cut(s) 215
BstYI RGATCY 1 cut(s) 215
BsuRI GGCC 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 172
Cfr13I GGNCC 2 cut(s) 32, 33
CviAII CATG 1 cut(s) 152
CviJI RGCY 4 cut(s) 34, 110, 116, 135
CviKI_1 RGCY 4 cut(s) 34, 110, 116, 135
DdeI CTNAG 1 cut(s) 206
DpnI GATC 2 cut(s) 166, 217
DpnII GATC 2 cut(s) 164, 215
Eco130I CCWWGG 1 cut(s) 111
Eco24I GRGCYC 1 cut(s) 36
EcoO109I RGGNCCY 2 cut(s) 32, 33
EcoRII CCWGG 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 111
EcoT38I GRGCYC 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 1 cut(s) 155
FaiI YATR 3 cut(s) 103, 153, 203
FatI CATG 1 cut(s) 151
FriOI GRGCYC 1 cut(s) 36
FspBI CTAG 1 cut(s) 27
GsuI CTGGAG 1 cut(s) 151
HaeIII GGCC 1 cut(s) 34
Hin1II CATG 1 cut(s) 155
HinfI GANTC 1 cut(s) 22
Hpy166II GTNNAC 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 21
HpyF3I CTNAG 1 cut(s) 206
Hsp92II CATG 1 cut(s) 155
Kzo9I GATC 2 cut(s) 164, 215
LmnI GCTCC 1 cut(s) 132
LpnPI CCDG 4 cut(s) 63, 90, 110, 115
MaeI CTAG 1 cut(s) 27
MaeIII GTNAC 2 cut(s) 141, 189
MalI GATC 2 cut(s) 166, 217
MboI GATC 2 cut(s) 164, 215
MflI RGATCY 1 cut(s) 215
MhlI GDGCHC 1 cut(s) 36
MlyI GAGTC 1 cut(s) 16
MnlI CCTC 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 78
NdeII GATC 2 cut(s) 164, 215
NlaIII CATG 1 cut(s) 155
NlaIV GGNNCC 3 cut(s) 34, 35, 134
NspI RCATGY 1 cut(s) 155
PciI ACATGT 1 cut(s) 151
PleI GAGTC 1 cut(s) 16
PpsI GAGTC 1 cut(s) 16
PscI ACATGT 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PspN4I GGNNCC 3 cut(s) 34, 35, 134
PspOMI GGGCCC 1 cut(s) 32
PspPI GGNCC 2 cut(s) 32, 33
PsuI RGATCY 1 cut(s) 215
Sau3AI GATC 2 cut(s) 164, 215
Sau96I GGNCC 2 cut(s) 32, 33
SchI GAGTC 1 cut(s) 16
ScrFI CCNGG 1 cut(s) 78
SduI GDGCHC 1 cut(s) 36
SetI ASST 1 cut(s) 8
SsiI CCGC 1 cut(s) 187
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 76
StyI CCWWGG 1 cut(s) 111
XceI RCATGY 1 cut(s) 155
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.