Rroxscaffold_3G00248050

Oxidation resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0005395
Physical Location & Seq
Reverse (-)
41364522 .. 41365685
1164 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00248050.1

Sequence Viewer

Length: 192 bp
ATGTGTTTGAATAATATGCTAGCTTTTGGGGGTGGCGGTAACTTTGCTCTATGCTTAGATGGAGATCTGTTAAGCGGAACTAGCGGACCTTATGAAACATTTGGGAACTTATGCTTGGCTCATAAACCAGAGTTTGAATTGAAGAATGTTGAGCTTTGGGGCTTTACACATGCATCACGGTATCTTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TLD

Protein Analysis

63

Amino Acids

6.83

Weight (kDa)

4.97

Isoelectric Point (pI)

25.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TLD PF07534 3 - 55 1.5e-10 TLDc domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 36, 75, 84
AgsI TTSAA 3 cut(s) 10, 137, 142
AjuI GAANNNNNNNTTGG 2 cut(s) 98, 130
AluBI AGCT 2 cut(s) 23, 154
AluI AGCT 2 cut(s) 23, 154
AspS9I GGNCC 1 cut(s) 86
AsuNHI GCTAGC 1 cut(s) 19
AvaII GGWCC 1 cut(s) 86
BccI CCATC 1 cut(s) 53
BfaI CTAG 2 cut(s) 20, 81
BglII AGATCT 1 cut(s) 64
Bme18I GGWCC 1 cut(s) 86
BmgT120I GGNCC 1 cut(s) 86
BmsI GCATC 1 cut(s) 182
BmtI GCTAGC 1 cut(s) 23
BsaBI GATNNNNATC 1 cut(s) 63
Bse8I GATNNNNATC 1 cut(s) 63
BseJI GATNNNNATC 1 cut(s) 63
Bsp143I GATC 1 cut(s) 64
BspACI CCGC 3 cut(s) 36, 75, 84
BspOI GCTAGC 1 cut(s) 23
BssMI GATC 1 cut(s) 64
Bst4CI ACNGT 1 cut(s) 180
BstC8I GCNNGC 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 55
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstNSI RCATGY 1 cut(s) 173
BstX2I RGATCY 1 cut(s) 64
BstYI RGATCY 1 cut(s) 64
Cac8I GCNNGC 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 86
CviAII CATG 1 cut(s) 170
CviJI RGCY 4 cut(s) 23, 119, 154, 162
CviKI_1 RGCY 4 cut(s) 23, 119, 154, 162
DdeI CTNAG 1 cut(s) 55
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
Eco47I GGWCC 1 cut(s) 86
EcoT22I ATGCAT 1 cut(s) 175
FaeI CATG 1 cut(s) 173
FaiI YATR 6 cut(s) 17, 52, 93, 112, 123, 171
FatI CATG 1 cut(s) 169
FspBI CTAG 2 cut(s) 20, 81
Hin1II CATG 1 cut(s) 173
Hpy188III TCNNGA 1 cut(s) 189
HpyCH4III ACNGT 1 cut(s) 180
HpyCH4V TGCA 1 cut(s) 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
HpyF3I CTNAG 1 cut(s) 55
Hsp92II CATG 1 cut(s) 173
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 1 cut(s) 141
LweI GCATC 1 cut(s) 182
MaeI CTAG 2 cut(s) 20, 81
MaeIII GTNAC 1 cut(s) 38
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 1 cut(s) 154
MflI RGATCY 1 cut(s) 64
MluCI AATT 1 cut(s) 137
Mph1103I ATGCAT 1 cut(s) 175
MseI TTAA 1 cut(s) 71
MwoI GCNNNNNNNGC 1 cut(s) 81
NdeII GATC 1 cut(s) 64
NheI GCTAGC 1 cut(s) 19
NlaIII CATG 1 cut(s) 173
NsiI ATGCAT 1 cut(s) 175
NspI RCATGY 1 cut(s) 173
PspPI GGNCC 1 cut(s) 86
PsuI RGATCY 1 cut(s) 64
SaqAI TTAA 1 cut(s) 71
Sau3AI GATC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 86
SetI ASST 3 cut(s) 25, 91, 156
SfaNI GCATC 1 cut(s) 182
SgeI CNNG 5 cut(s) 32, 93, 127, 140, 182
SinI GGWCC 1 cut(s) 86
Sse9I AATT 1 cut(s) 137
SsiI CCGC 3 cut(s) 36, 75, 84
SspMI CTAG 2 cut(s) 20, 81
TaaI ACNGT 1 cut(s) 180
TasI AATT 1 cut(s) 137
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TspDTI ATGAA 1 cut(s) 108
VpaK11BI GGWCC 1 cut(s) 86
XceI RCATGY 1 cut(s) 173
XspI CTAG 2 cut(s) 20, 81
Zsp2I ATGCAT 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.