Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0042636.1

Orthogroup ID

OG0010652

Physical Location & Seq

Genomic Coordinates Reverse (-)

7 .. 2154

Gene Structure 2148 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0042636.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 483 bp

atgaagatttcgagaagcattttcgattcggctggtaaggttcggactctggaggagatattaaccattgagatcaaacctggttggaagaaaggcaccaagataaccttccctgagaagggtaatcaagagcctggtgttattccagcagatctgatttttgtagttgatgaaaaacctcatgcactttttaagagggacggtaatgatctggtggtgaaccaggagatcacactgctggaggcactcactgggaagaatcttgaactaactaccctggatggtaggaatcttatgatcccgttgaccgatatcatcaaacctggggctgaaatggttgtaccaaatgaaggaatgccaatctcaaaagaaccagggagaaagggaaatttgagaatcaggtttgatgtcaagtatccttcaagacttactacagaacagaaatcagatttgaaaagagttttgggaggagtttcattatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001671 GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005829 GO:0005886 GO:0008047 GO:0008150 GO:0016020 GO:0030234 GO:0031974 GO:0031981 GO:0032781 GO:0043085 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043462 GO:0044093 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0050790 GO:0051087 GO:0051336 GO:0051345 GO:0060589 GO:0060590 GO:0065007 GO:0065009 GO:0070013 GO:0071944 GO:0098772

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ DnaJ_C

Protein Analysis

160

Amino Acids

17.77

Weight (kDa)

9.12

Isoelectric Point (pI)

38.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010652)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G47940
fragaria_vesca	FvH4_5g15710
malus_domestica	MD06G1186100.v1.1 MD07G1162200.v1.1 MD07G1162300.v1.1 MD14G1192300.v1.1
prunus_persica	Prupe.5G184900_v2.0.a1
pyrus_communis	pycom06g16550 pycom14g16000
rosa_chinensis	RchiOBHm_Chr7g0180401
rosa_laevigata	RLG00000005270
rosa_multiflora	Rmu_sc0018872.1_g000002 Rmu_sc0042636.1_g000001
rosa_roxburghii	Rroxscaffold_3G00272920
rosa_rugosa	Rorug06G0432800
rosa_samantha	Rh7AG033400 Rh7BG033300 Rh7CG035300 Rh7DG033800
rosa_wichuraiana	Rw7G002790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	95
AclWI	GGATC	1 cut(s)	292
AcsI	RAATTY	1 cut(s)	388
AfaI	GTAC	1 cut(s)	342
AfiI	CCNNNNNNNGG	3 cut(s)	118, 119, 350
AgsI	TTSAA	3 cut(s)	266, 423, 454
AjnI	CCWGG	6 cut(s)	79, 133, 222, 276, 322, 373
AjuI	GAANNNNNNNTTGG	4 cut(s)	92, 124, 446, 478
AlwI	GGATC	1 cut(s)	292
ApoI	RAATTY	1 cut(s)	388
AsuHPI	GGTGA	1 cut(s)	229
BanI	GGYRCC	1 cut(s)	95
BccI	CCATC	1 cut(s)	275
BciT130I	CCWGG	6 cut(s)	81, 135, 224, 278, 324, 375
BciVI	GTATCC	1 cut(s)	426
BfmI	CTRYAG	1 cut(s)	432
BfuI	GTATCC	1 cut(s)	426
BglII	AGATCT	1 cut(s)	151
Bme1390I	CCNGG	6 cut(s)	81, 135, 224, 278, 324, 375
BmiI	GGNNCC	1 cut(s)	97
BmrFI	CCNGG	6 cut(s)	81, 135, 224, 278, 324, 375
BmrI	ACTGGG	1 cut(s)	261
BmuI	ACTGGG	1 cut(s)	261
BpmI	CTGGAG	2 cut(s)	71, 260
BsaJI	CCNNGG	3 cut(s)	276, 323, 374
Bsc4I	CCNNNNNNNGG	3 cut(s)	118, 119, 350
Bse1I	ACTGG	1 cut(s)	256
BseBI	CCWGG	6 cut(s)	81, 135, 224, 278, 324, 375
BseDI	CCNNGG	3 cut(s)	276, 323, 374
BseGI	GGATG	1 cut(s)	286
BseLI	CCNNNNNNNGG	3 cut(s)	118, 119, 350
BseMII	CTCAG	1 cut(s)	105
BseNI	ACTGG	1 cut(s)	256
BseRI	GAGGAG	2 cut(s)	68, 483
BshNI	GGYRCC	1 cut(s)	95
BslFI	GGGAC	1 cut(s)	212
BslI	CCNNNNNNNGG	3 cut(s)	118, 119, 350
BsmFI	GGGAC	1 cut(s)	212
BsmI	GAATGC	1 cut(s)	360
Bsp143I	GATC	5 cut(s)	72, 151, 208, 228, 297
BspCNI	CTCAG	1 cut(s)	106
BspLI	GGNNCC	1 cut(s)	97
BspPI	GGATC	1 cut(s)	292
BspT107I	GGYRCC	1 cut(s)	95
BsrI	ACTGG	1 cut(s)	256
BssECI	CCNNGG	3 cut(s)	276, 323, 374
BssMI	GATC	5 cut(s)	72, 151, 208, 228, 297
Bst2UI	CCWGG	6 cut(s)	81, 135, 224, 278, 324, 375
Bst4CI	ACNGT	1 cut(s)	203
BstDEI	CTNAG	1 cut(s)	114
BstF5I	GGATG	1 cut(s)	286
BstKTI	GATC	5 cut(s)	75, 154, 211, 231, 300
BstMBI	GATC	5 cut(s)	72, 151, 208, 228, 297
BstNI	CCWGG	6 cut(s)	81, 135, 224, 278, 324, 375
BstSCI	CCNGG	6 cut(s)	79, 133, 222, 276, 322, 373
BstSFI	CTRYAG	1 cut(s)	432
BstX2I	RGATCY	1 cut(s)	151
BstYI	RGATCY	1 cut(s)	151
BsuI	GTATCC	1 cut(s)	426
BtsCI	GGATG	1 cut(s)	286
BtsI	GCAGTG	1 cut(s)	233
BtsIMutI	CAGTG	2 cut(s)	233, 249
CsiI	ACCWGGT	1 cut(s)	79
Csp6I	GTAC	1 cut(s)	341
CviAII	CATG	1 cut(s)	182
CviJI	RGCY	3 cut(s)	32, 133, 329
CviKI_1	RGCY	3 cut(s)	32, 133, 329
CviQI	GTAC	1 cut(s)	341
DdeI	CTNAG	1 cut(s)	114
DpnI	GATC	5 cut(s)	74, 153, 210, 230, 299
DpnII	GATC	5 cut(s)	72, 151, 208, 228, 297
Eco32I	GATATC	1 cut(s)	313
EcoRII	CCWGG	6 cut(s)	79, 133, 222, 276, 322, 373
EcoRV	GATATC	1 cut(s)	313
FaeI	CATG	1 cut(s)	185
FaiI	YATR	3 cut(s)	183, 296, 481
FalI	AAGNNNNNCTT	2 cut(s)	92, 124
FaqI	GGGAC	1 cut(s)	212
FatI	CATG	1 cut(s)	181
FokI	GGATG	1 cut(s)	293
GsuI	CTGGAG	2 cut(s)	71, 260
Hin1II	CATG	1 cut(s)	185
HincII	GTYRAC	1 cut(s)	306
HindII	GTYRAC	1 cut(s)	306
HinfI	GANTC	5 cut(s)	26, 46, 259, 289, 396
HphI	GGTGA	1 cut(s)	229
Hpy166II	GTNNAC	2 cut(s)	220, 306
Hpy188I	TCNGA	3 cut(s)	45, 156, 448
Hpy188III	TCNNGA	5 cut(s)	12, 50, 128, 263, 423
Hpy8I	GTNNAC	2 cut(s)	220, 306
HpyAV	CCTTC	4 cut(s)	112, 118, 344, 429
HpyCH4III	ACNGT	1 cut(s)	203
HpyCH4V	TGCA	1 cut(s)	185
HpyF3I	CTNAG	1 cut(s)	114
Hsp92II	CATG	1 cut(s)	185
Kzo9I	GATC	5 cut(s)	72, 151, 208, 228, 297
MabI	ACCWGGT	1 cut(s)	79
MalI	GATC	5 cut(s)	74, 153, 210, 230, 299
MboI	GATC	5 cut(s)	72, 151, 208, 228, 297
MboII	GAAGA	3 cut(s)	16, 100, 268
MflI	RGATCY	1 cut(s)	151
MluCI	AATT	1 cut(s)	388
MlyI	GAGTC	1 cut(s)	40
MmeI	TCCRAC	1 cut(s)	65
MnlI	CCTC	5 cut(s)	46, 189, 189, 235, 461
MseI	TTAA	2 cut(s)	62, 192
MspR9I	CCNGG	6 cut(s)	81, 135, 224, 278, 324, 375
Mva1269I	GAATGC	1 cut(s)	360
MvaI	CCWGG	6 cut(s)	81, 135, 224, 278, 324, 375
NdeII	GATC	5 cut(s)	72, 151, 208, 228, 297
NlaIII	CATG	1 cut(s)	185
NlaIV	GGNNCC	1 cut(s)	97
PctI	GAATGC	1 cut(s)	360
PfeI	GAWTC	4 cut(s)	26, 259, 289, 396
PleI	GAGTC	1 cut(s)	40
PpsI	GAGTC	1 cut(s)	40
Psp6I	CCWGG	6 cut(s)	79, 133, 222, 276, 322, 373
PspGI	CCWGG	6 cut(s)	79, 133, 222, 276, 322, 373
PspN4I	GGNNCC	1 cut(s)	97
PsuI	RGATCY	1 cut(s)	151
RsaI	GTAC	1 cut(s)	342
RsaNI	GTAC	1 cut(s)	341
SaqAI	TTAA	2 cut(s)	62, 192
Sau3AI	GATC	5 cut(s)	72, 151, 208, 228, 297
SchI	GAGTC	1 cut(s)	40
ScrFI	CCNGG	6 cut(s)	81, 135, 224, 278, 324, 375
SetI	ASST	6 cut(s)	42, 82, 110, 181, 325, 404
SexAI	ACCWGGT	1 cut(s)	79
SfcI	CTRYAG	1 cut(s)	432
Sse9I	AATT	1 cut(s)	388
StyD4I	CCNGG	6 cut(s)	79, 133, 222, 276, 322, 373
TaaI	ACNGT	1 cut(s)	203
TaqI	TCGA	2 cut(s)	11, 24
TaqII	GACCGA	1 cut(s)	323
TasI	AATT	1 cut(s)	388
TfiI	GAWTC	4 cut(s)	26, 259, 289, 396
Tru1I	TTAA	2 cut(s)	62, 192
Tru9I	TTAA	2 cut(s)	62, 192
TscAI	CASTG	2 cut(s)	240, 256
TspDTI	ATGAA	4 cut(s)	17, 186, 363, 465
TspRI	CASTG	2 cut(s)	240, 256
XapI	RAATTY	1 cut(s)	388

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.