Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000006.1

Orthogroup ID

OG0003168

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 810

Gene Structure 809 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000006.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 809 bp

atgtcgatctccggcgaccaaacccaccgccaccctcacatcctagtctacccttaccctgcacaaggccacatgctaccactcctcgacctaaccaaccaactagccctccgcgccctcaccataacaatcgtcgtcacccccaaaaacctcccaaccctcacacctctcctctccacccacccctcaatccaaaccctcgtcctcccatttccttcacaccccaaaataccccccggcgttgaaaacatcaaggacatcggcccccacggcaacctcgccgtcatcaacgccctcgccaagctccacgacccgatcatccagtggttcgagtcccaccctaacccccctgtcgctctcatctcagacttctttctcggctacactctccgcctcgccgaccacctcaaaatcccgagaataaccttcttctcgtccggagctttcttggcctcgattcaagagtactgttggcgaaacctagatctggtccagtcgtcgtcggttattgacttcccctatgttcctcggtcgccctcgttgaaaaaggagcacgtgccgtcgattgtgttggctcacagaggaacggatcccgagtctgagcttttgagggtttccatgcttgccaataccgacagttggggctgtgttttcaatacctttgaggacttggagggtgagtatttggatcacttgaggagaagcatgggccacaaccgggtttacagcgtcggcccattgagtctgatttatgccggagatggtggtttggatcggggaaacctgaacacgggttccggtggcgattt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008194 GO:0016740 GO:0016757 GO:0016758 GO:0035251 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0046527 GO:0080043 GO:0080044

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

269

Amino Acids

29.7

Weight (kDa)

6.25

Isoelectric Point (pI)

39.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003168)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G51210 AT5G03490
fragaria_vesca	FvH4_4g29060 FvH4_4g29061
malus_domestica	MD16G1054300.v1.1 MD16G1054500.v1.1 MD16G1054600.v1.1
prunus_persica	Prupe.1G295300_v2.0.a1
pyrus_communis	pycom16g04730 pycom16g04740 pycom16g04750
rosa_chinensis	RchiOBHm_Chr4g0437141 RchiOBHm_Chr4g0437161
rosa_laevigata	RLG00000006459 RLG00000006463 RLG00000006464 RLG00000009364
rosa_multiflora	Rmu_co8368091.1_g000001 Rmu_sc0000591.1_g000008 Rmu_sc0000591.1_g000012 Rmu_sc0017900.1_g000001 Rmu_sc0017900.1_g000006 Rmu_ssc0000006.1_g000001
rosa_roxburghii	Rroxscaffold_5G00378220 Rroxscaffold_5G00378300
rosa_rugosa	Rorug04G0298300 Rorug04G0298400.1
rosa_samantha	Rh4AG353300 Rh4BG362900 Rh4BG363000 Rh4BG363200 Rh4CG377100 Rh4CG377300 Rh4DG356800 Rh4DG357000
rosa_wichuraiana	Rw4G030950 Rw4G030960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	48
AccII	CGCG	1 cut(s)	114
AccIII	TCCGGA	1 cut(s)	437
AciI	CCGC	3 cut(s)	28, 112, 391
AclWI	GGATC	4 cut(s)	584, 597, 696, 780
AcvI	CACGTG	1 cut(s)	556
AfaI	GTAC	1 cut(s)	467
AfiI	CCNNNNNNNGG	5 cut(s)	65, 487, 639, 718, 790
AgsI	TTSAA	4 cut(s)	245, 461, 544, 655
AloI	GAACNNNNNNTCC	1 cut(s)	779
AluBI	AGCT	3 cut(s)	304, 443, 604
AluI	AGCT	3 cut(s)	304, 443, 604
Alw21I	GWGCWC	1 cut(s)	555
AlwI	GGATC	4 cut(s)	584, 597, 696, 780
Ama87I	CYCGRG	2 cut(s)	415, 593
Aor13HI	TCCGGA	1 cut(s)	437
AoxI	GGCC	5 cut(s)	67, 262, 450, 709, 733
AspLEI	GCGC	1 cut(s)	116
AspS9I	GGNCC	4 cut(s)	263, 490, 709, 734
AsuC2I	CCSGG	2 cut(s)	237, 719
AsuHPI	GGTGA	3 cut(s)	112, 130, 689
AvaI	CYCGRG	2 cut(s)	415, 593
AvaII	GGWCC	1 cut(s)	490
BamHI	GGATCC	1 cut(s)	589
BbrPI	CACGTG	1 cut(s)	556
Bbv12I	GWGCWC	1 cut(s)	555
BccI	CCATC	1 cut(s)	755
BceAI	ACGGC	3 cut(s)	266, 286, 544
BcnI	CCSGG	2 cut(s)	237, 719
BfaI	CTAG	3 cut(s)	44, 104, 482
BglI	GCCNNNNNGGC	1 cut(s)	270
BglII	AGATCT	1 cut(s)	484
BmcAI	AGTACT	1 cut(s)	467
Bme1390I	CCNGG	2 cut(s)	237, 719
Bme18I	GGWCC	1 cut(s)	490
BmeT110I	CYCGRG	2 cut(s)	415, 593
BmgT120I	GGNCC	4 cut(s)	263, 490, 709, 734
BmiI	GGNNCC	3 cut(s)	265, 591, 796
BmrFI	CCNGG	2 cut(s)	237, 719
BpuEI	CTTGAG	1 cut(s)	715
BpuMI	CCSGG	2 cut(s)	237, 719
BsaAI	YACGTR	1 cut(s)	556
BsaJI	CCNNGG	3 cut(s)	235, 268, 527
BsaWI	WCCGGW	2 cut(s)	437, 797
BsaXI	ACNNNNNCTCC	4 cut(s)	93, 123, 665, 695
Bsc4I	CCNNNNNNNGG	5 cut(s)	65, 487, 639, 718, 790
Bse1I	ACTGG	2 cut(s)	322, 493
BseAI	TCCGGA	1 cut(s)	437
BseDI	CCNNGG	3 cut(s)	235, 268, 527
BseGI	GGATG	2 cut(s)	39, 318
BseLI	CCNNNNNNNGG	5 cut(s)	65, 487, 639, 718, 790
BseMII	CTCAG	2 cut(s)	378, 591
BseNI	ACTGG	2 cut(s)	322, 493
BseRI	GAGGAG	3 cut(s)	74, 161, 712
BsgI	GTGCAG	1 cut(s)	45
Bsh1236I	CGCG	1 cut(s)	114
Bsh1285I	CGRYCG	1 cut(s)	533
BshFI	GGCC	5 cut(s)	69, 264, 452, 711, 735
BsiEI	CGRYCG	1 cut(s)	533
BsiHKAI	GWGCWC	1 cut(s)	555
BsiHKCI	CYCGRG	2 cut(s)	415, 593
BsiSI	CCGG	6 cut(s)	12, 237, 438, 718, 756, 798
BslFI	GGGAC	1 cut(s)	319
BslI	CCNNNNNNNGG	5 cut(s)	65, 487, 639, 718, 790
BsmFI	GGGAC	1 cut(s)	319
BsnI	GGCC	5 cut(s)	69, 264, 452, 711, 735
BsoBI	CYCGRG	2 cut(s)	415, 593
Bsp1286I	GDGCHC	1 cut(s)	555
Bsp13I	TCCGGA	1 cut(s)	437
Bsp143I	GATC	6 cut(s)	6, 315, 484, 589, 688, 772
BspACI	CCGC	3 cut(s)	28, 112, 391
BspANI	GGCC	5 cut(s)	69, 264, 452, 711, 735
BspCNI	CTCAG	2 cut(s)	377, 592
BspEI	TCCGGA	1 cut(s)	437
BspFNI	CGCG	1 cut(s)	114
BspLI	GGNNCC	3 cut(s)	265, 591, 796
BspPI	GGATC	4 cut(s)	584, 597, 696, 780
BsrI	ACTGG	2 cut(s)	322, 493
BssECI	CCNNGG	3 cut(s)	235, 268, 527
BssMI	GATC	6 cut(s)	6, 315, 484, 589, 688, 772
Bst4CI	ACNGT	2 cut(s)	470, 638
BstBAI	YACGTR	1 cut(s)	556
BstC8I	GCNNGC	1 cut(s)	624
BstDEI	CTNAG	2 cut(s)	364, 600
BstDSI	CCRYGG	1 cut(s)	268
BstENI	CCTNNNNNAGG	1 cut(s)	63
BstF5I	GGATG	2 cut(s)	39, 318
BstFNI	CGCG	1 cut(s)	114
BstHHI	GCGC	1 cut(s)	116
BstKTI	GATC	6 cut(s)	9, 318, 487, 592, 691, 775
BstMBI	GATC	6 cut(s)	6, 315, 484, 589, 688, 772
BstMCI	CGRYCG	1 cut(s)	533
BstMWI	GCNNNNNNNGC	3 cut(s)	113, 270, 449
BstNSI	RCATGY	1 cut(s)	76
BstSCI	CCNGG	2 cut(s)	235, 717
BstUI	CGCG	1 cut(s)	114
BstX2I	RGATCY	2 cut(s)	484, 589
BstYI	RGATCY	2 cut(s)	484, 589
BsuRI	GGCC	5 cut(s)	69, 264, 452, 711, 735
BtgI	CCRYGG	1 cut(s)	268
BtsCI	GGATG	2 cut(s)	39, 318
BtsIMutI	CAGTG	1 cut(s)	329
Cac8I	GCNNGC	1 cut(s)	624
CfoI	GCGC	1 cut(s)	116
Cfr13I	GGNCC	4 cut(s)	263, 490, 709, 734
CseI	GACGC	1 cut(s)	718
Csp6I	GTAC	1 cut(s)	466
CviAII	CATG	3 cut(s)	73, 619, 706
CviQI	GTAC	1 cut(s)	466
DdeI	CTNAG	2 cut(s)	364, 600
DpnI	GATC	6 cut(s)	8, 317, 486, 591, 690, 774
DpnII	GATC	6 cut(s)	6, 315, 484, 589, 688, 772
EciI	GGCGGA	1 cut(s)	380
Eco47I	GGWCC	1 cut(s)	490
Eco72I	CACGTG	1 cut(s)	556
Eco88I	CYCGRG	2 cut(s)	415, 593
EcoNI	CCTNNNNNAGG	1 cut(s)	63
FaeI	CATG	3 cut(s)	76, 622, 709
FaiI	YATR	6 cut(s)	74, 125, 522, 620, 707, 753
FaqI	GGGAC	1 cut(s)	319
FatI	CATG	3 cut(s)	72, 618, 705
FblI	GTMKAC	1 cut(s)	48
FokI	GGATG	2 cut(s)	26, 305
FspBI	CTAG	3 cut(s)	44, 104, 482
GlaI	GCGC	1 cut(s)	115
HaeIII	GGCC	5 cut(s)	69, 264, 452, 711, 735
HapII	CCGG	6 cut(s)	12, 237, 438, 718, 756, 798
HgaI	GACGC	1 cut(s)	718
HhaI	GCGC	1 cut(s)	116
Hin1II	CATG	3 cut(s)	76, 622, 709
Hin6I	GCGC	1 cut(s)	114
HinP1I	GCGC	1 cut(s)	114
HinfI	GANTC	4 cut(s)	332, 457, 596, 742
HpaII	CCGG	6 cut(s)	12, 237, 438, 718, 756, 798
HphI	GGTGA	3 cut(s)	112, 130, 689
Hpy166II	GTNNAC	2 cut(s)	49, 724
Hpy188I	TCNGA	3 cut(s)	367, 601, 747
Hpy188III	TCNNGA	4 cut(s)	415, 438, 461, 593
Hpy8I	GTNNAC	2 cut(s)	49, 724
Hpy99I	CGWCG	5 cut(s)	137, 502, 505, 565, 734
HpyAV	CCTTC	2 cut(s)	225, 436
HpyCH4III	ACNGT	2 cut(s)	470, 638
HpyCH4IV	ACGT	1 cut(s)	555
HpyCH4V	TGCA	1 cut(s)	62
HpyF10VI	GCNNNNNNNGC	3 cut(s)	113, 270, 449
HpyF3I	CTNAG	2 cut(s)	364, 600
HpySE526I	ACGT	1 cut(s)	555
Hsp92II	CATG	3 cut(s)	76, 622, 709
HspAI	GCGC	1 cut(s)	114
Kpn2I	TCCGGA	1 cut(s)	437
Kzo9I	GATC	6 cut(s)	6, 315, 484, 589, 688, 772
LmnI	GCTCC	3 cut(s)	309, 440, 550
MaeI	CTAG	3 cut(s)	44, 104, 482
MaeII	ACGT	1 cut(s)	555
MaeIII	GTNAC	1 cut(s)	136
MalI	GATC	6 cut(s)	8, 317, 486, 591, 690, 774
MboI	GATC	6 cut(s)	6, 315, 484, 589, 688, 772
MboII	GAAGA	1 cut(s)	421
MflI	RGATCY	2 cut(s)	484, 589
MhlI	GDGCHC	1 cut(s)	555
MlyI	GAGTC	3 cut(s)	341, 605, 751
MroI	TCCGGA	1 cut(s)	437
MspI	CCGG	6 cut(s)	12, 237, 438, 718, 756, 798
MspR9I	CCNGG	2 cut(s)	237, 719
MvnI	CGCG	1 cut(s)	114
MwoI	GCNNNNNNNGC	3 cut(s)	113, 270, 449
NciI	CCSGG	2 cut(s)	237, 719
NdeII	GATC	6 cut(s)	6, 315, 484, 589, 688, 772
NlaIII	CATG	3 cut(s)	76, 622, 709
NlaIV	GGNNCC	3 cut(s)	265, 591, 796
NmeAIII	GCCGAG	1 cut(s)	357
NmuCI	GTSAC	1 cut(s)	136
NspI	RCATGY	1 cut(s)	76
PfeI	GAWTC	1 cut(s)	457
PleI	GAGTC	3 cut(s)	340, 604, 750
PmaCI	CACGTG	1 cut(s)	556
PmlI	CACGTG	1 cut(s)	556
PpsI	GAGTC	3 cut(s)	340, 604, 750
Ppu21I	YACGTR	1 cut(s)	556
PspCI	CACGTG	1 cut(s)	556
PspN4I	GGNNCC	3 cut(s)	265, 591, 796
PspPI	GGNCC	4 cut(s)	263, 490, 709, 734
PsuI	RGATCY	2 cut(s)	484, 589
RsaI	GTAC	1 cut(s)	467
RsaNI	GTAC	1 cut(s)	466
Sau3AI	GATC	6 cut(s)	6, 315, 484, 589, 688, 772
Sau96I	GGNCC	4 cut(s)	263, 490, 709, 734
ScaI	AGTACT	1 cut(s)	467
SchI	GAGTC	3 cut(s)	341, 605, 751
ScrFI	CCNGG	2 cut(s)	237, 719
SduI	GDGCHC	1 cut(s)	555
SinI	GGWCC	1 cut(s)	490
SmlI	CTYRAG	1 cut(s)	694
SmoI	CTYRAG	1 cut(s)	694
SsiI	CCGC	3 cut(s)	28, 112, 391
SspMI	CTAG	3 cut(s)	44, 104, 482
StyD4I	CCNGG	2 cut(s)	235, 717
TaaI	ACNGT	2 cut(s)	470, 638
TaiI	ACGT	1 cut(s)	558
TaqI	TCGA	5 cut(s)	5, 87, 330, 455, 563
TaqII	GACCGA	1 cut(s)	519
TatI	WGTACW	1 cut(s)	465
TfiI	GAWTC	1 cut(s)	457
TscAI	CASTG	1 cut(s)	329
TseFI	GTSAC	1 cut(s)	136
Tsp45I	GTSAC	1 cut(s)	136
TspGWI	ACGGA	1 cut(s)	602
TspRI	CASTG	1 cut(s)	329
VpaK11BI	GGWCC	1 cut(s)	490
XagI	CCTNNNNNAGG	1 cut(s)	63
XceI	RCATGY	1 cut(s)	76
XmiI	GTMKAC	1 cut(s)	48
XspI	CTAG	3 cut(s)	44, 104, 482
ZrmI	AGTACT	1 cut(s)	467

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.