Rmu_ssc0000141.1_g000013

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000141.1
OG0006897
Physical Location & Seq
Reverse (-)
63494 .. 63965
472 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000141.1_g000013.1.cds

Sequence Viewer

Length: 372 bp
atgagggcttggctttgggggtttttggtcctggtgaggctcgtccaccatctattctcagcaggcgtgactatgggaggctgcattgaacgattgctctctaaatcgtcgttggaaagtcaaaattgggagcacatattcaacgccatggtccagattttacaggagcagcagtccaagctggagacgatggccaaagacagcaaaatgcgtgccgatcagatcagaacagaacacgacaagtgggccttcaacgtcagccaattgcaaaatcaaatttcccagttggaggcggatttggtaatgcaagagaagggtggtgtggttgaggtggccaaattggagttgcttctgggcttgaaggaaaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

14.15

Weight (kDa)

6.41

Isoelectric Point (pI)

41.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 293
AcoI YGGCCR 2 cut(s) 192, 333
AcsI RAATTY 1 cut(s) 276
AfiI CCNNNNNNNGG 1 cut(s) 289
AgsI TTSAA 4 cut(s) 89, 142, 253, 361
AjnI CCWGG 1 cut(s) 30
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
Alw21I GWGCWC 1 cut(s) 135
Alw26I GTCTC 1 cut(s) 179
AoxI GGCC 3 cut(s) 192, 246, 333
ApeKI GCWGC 2 cut(s) 81, 169
ApoI RAATTY 1 cut(s) 276
AspS9I GGNCC 3 cut(s) 28, 151, 246
AsuHPI GGTGA 1 cut(s) 46
AvaII GGWCC 2 cut(s) 28, 151
BalI TGGCCA 2 cut(s) 194, 335
Bbv12I GWGCWC 1 cut(s) 135
BbvI GCAGC 2 cut(s) 68, 181
BccI CCATC 2 cut(s) 57, 184
BciT130I CCWGG 1 cut(s) 32
BcoDI GTCTC 1 cut(s) 179
BisI GCNGC 2 cut(s) 82, 170
BlsI GCNGC 2 cut(s) 83, 171
Bme1390I CCNGG 1 cut(s) 32
Bme18I GGWCC 2 cut(s) 28, 151
BmgT120I GGNCC 3 cut(s) 28, 151, 246
BmrFI CCNGG 1 cut(s) 32
BmrI ACTGGG 1 cut(s) 277
BmuI ACTGGG 1 cut(s) 277
BpmI CTGGAG 1 cut(s) 203
BsaJI CCNNGG 1 cut(s) 147
BsaXI ACNNNNNCTCC 2 cut(s) 158, 188
Bsc4I CCNNNNNNNGG 1 cut(s) 289
Bse1I ACTGG 1 cut(s) 283
BseBI CCWGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 147
BseLI CCNNNNNNNGG 1 cut(s) 289
BseMII CTCAG 1 cut(s) 72
BseNI ACTGG 1 cut(s) 283
BseXI GCAGC 2 cut(s) 68, 181
BshFI GGCC 3 cut(s) 194, 248, 335
BsiHKAI GWGCWC 1 cut(s) 135
BslI CCNNNNNNNGG 1 cut(s) 289
BsmAI GTCTC 1 cut(s) 179
BsmBI CGTCTC 1 cut(s) 179
BsnI GGCC 3 cut(s) 194, 248, 335
Bsp1286I GDGCHC 1 cut(s) 135
Bsp143I GATC 2 cut(s) 217, 222
Bsp19I CCATGG 1 cut(s) 147
BspACI CCGC 1 cut(s) 293
BspANI GGCC 3 cut(s) 194, 248, 335
BspCNI CTCAG 1 cut(s) 71
BsrI ACTGG 1 cut(s) 283
BssECI CCNNGG 1 cut(s) 147
BssMI GATC 2 cut(s) 217, 222
BssT1I CCWWGG 1 cut(s) 147
Bst2UI CCWGG 1 cut(s) 32
BstC8I GCNNGC 2 cut(s) 64, 213
BstDEI CTNAG 1 cut(s) 58
BstDSI CCRYGG 1 cut(s) 147
BstKTI GATC 2 cut(s) 220, 225
BstMAI GTCTC 1 cut(s) 179
BstMBI GATC 2 cut(s) 217, 222
BstMWI GCNNNNNNNGC 1 cut(s) 178
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BstV1I GCAGC 2 cut(s) 68, 181
BsuRI GGCC 3 cut(s) 194, 248, 335
BtgI CCRYGG 1 cut(s) 147
Cac8I GCNNGC 2 cut(s) 64, 213
Cfr13I GGNCC 3 cut(s) 28, 151, 246
CviAII CATG 1 cut(s) 148
DdeI CTNAG 1 cut(s) 58
DpnI GATC 2 cut(s) 219, 224
DpnII GATC 2 cut(s) 217, 222
EaeI YGGCCR 2 cut(s) 192, 333
EciI GGCGGA 1 cut(s) 308
Eco130I CCWWGG 1 cut(s) 147
Eco47I GGWCC 2 cut(s) 28, 151
EcoRII CCWGG 1 cut(s) 30
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
Esp3I CGTCTC 1 cut(s) 179
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 74, 137, 149
FalI AAGNNNNNCTT 2 cut(s) 233, 265
FatI CATG 1 cut(s) 147
Fnu4HI GCNGC 2 cut(s) 82, 170
Fsp4HI GCNGC 2 cut(s) 82, 170
GluI GCNGC 2 cut(s) 82, 170
GsuI CTGGAG 1 cut(s) 203
HaeIII GGCC 3 cut(s) 194, 248, 335
Hin1II CATG 1 cut(s) 151
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 46
Hpy188I TCNGA 2 cut(s) 222, 227
Hpy188III TCNNGA 1 cut(s) 154
Hpy8I GTNNAC 1 cut(s) 46
Hpy99I CGWCG 1 cut(s) 112
HpyAV CCTTC 3 cut(s) 259, 307, 355
HpyCH4IV ACGT 1 cut(s) 255
HpyCH4V TGCA 3 cut(s) 84, 268, 307
HpyF10VI GCNNNNNNNGC 1 cut(s) 178
HpyF3I CTNAG 1 cut(s) 58
HpySE526I ACGT 1 cut(s) 255
Hsp92II CATG 1 cut(s) 151
Kzo9I GATC 2 cut(s) 217, 222
LmnI GCTCC 2 cut(s) 130, 166
LpnPI CCDG 8 cut(s) 17, 44, 48, 149, 167, 167, 296, 338
Lsp1109I GCAGC 2 cut(s) 68, 181
MaeII ACGT 1 cut(s) 255
MaeIII GTNAC 1 cut(s) 67
MalI GATC 2 cut(s) 219, 224
MboI GATC 2 cut(s) 217, 222
MfeI CAATTG 1 cut(s) 263
MhlI GDGCHC 1 cut(s) 135
MlsI TGGCCA 2 cut(s) 194, 335
MluCI AATT 4 cut(s) 124, 263, 276, 338
MluNI TGGCCA 2 cut(s) 194, 335
MmeI TCCRAC 2 cut(s) 93, 267
MnlI CCTC 4 cut(s) 30, 71, 283, 322
Mox20I TGGCCA 2 cut(s) 194, 335
MscI TGGCCA 2 cut(s) 194, 335
Msp20I TGGCCA 2 cut(s) 194, 335
MspR9I CCNGG 1 cut(s) 32
MunI CAATTG 1 cut(s) 263
MvaI CCWGG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 178
NcoI CCATGG 1 cut(s) 147
NdeII GATC 2 cut(s) 217, 222
NlaIII CATG 1 cut(s) 151
NmuCI GTSAC 1 cut(s) 67
PkrI GCNGC 2 cut(s) 83, 171
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
PspPI GGNCC 3 cut(s) 28, 151, 246
SatI GCNGC 2 cut(s) 82, 170
Sau3AI GATC 2 cut(s) 217, 222
Sau96I GGNCC 3 cut(s) 28, 151, 246
ScrFI CCNGG 1 cut(s) 32
SduI GDGCHC 1 cut(s) 135
SetI ASST 4 cut(s) 183, 258, 333, 371
SinI GGWCC 2 cut(s) 28, 151
Sse9I AATT 4 cut(s) 124, 263, 276, 338
SsiI CCGC 1 cut(s) 293
StyD4I CCNGG 1 cut(s) 30
StyI CCWWGG 1 cut(s) 147
TaiI ACGT 1 cut(s) 258
TasI AATT 4 cut(s) 124, 263, 276, 338
TseFI GTSAC 1 cut(s) 67
TseI GCWGC 2 cut(s) 81, 169
Tsp45I GTSAC 1 cut(s) 67
VpaK11BI GGWCC 2 cut(s) 28, 151
XapI RAATTY 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.