Rh1BG155400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
25376353 .. 25378395
2043 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG155400.1

Sequence Viewer

Length: 264 bp
ATGAGGAGTATCAGGCATGTCTCGAGCCACTTTTCAGAGATGGATTTTTCAAACATAGCGAAGAAGCTTGACCTCTCCAACTCCAAGAATGTCGTCGGCCTCTCTAACAACCACAATCTGGTGCTCCTGCTTCCAGAAAGAGGAGGTTCATACCAAAAGCTCATACAAAGGCTGAAGTTTAACCCGACCCGGAGGAGGAAGAGCAAGCTAGACATGCTGAAAAGGAGAGGGAGTTGCTCATACGTTTCCATGAACAATCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.06

Weight (kDa)

11.03

Isoelectric Point (pI)

51.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 118
AcuI CTGAAG 1 cut(s) 194
AfiI CCNNNNNNNGG 3 cut(s) 118, 140, 195
AgsI TTSAA 1 cut(s) 51
AluBI AGCT 3 cut(s) 67, 160, 208
AluI AGCT 3 cut(s) 67, 160, 208
Alw21I GWGCWC 1 cut(s) 126
Alw26I GTCTC 1 cut(s) 25
Ama87I CYCGRG 1 cut(s) 22
AoxI GGCC 1 cut(s) 97
AsuC2I CCSGG 1 cut(s) 190
AvaI CYCGRG 1 cut(s) 22
Bbv12I GWGCWC 1 cut(s) 126
BccI CCATC 1 cut(s) 34
BcnI CCSGG 1 cut(s) 190
BcoDI GTCTC 1 cut(s) 25
BfaI CTAG 1 cut(s) 209
Bme1390I CCNGG 1 cut(s) 190
BmeT110I CYCGRG 1 cut(s) 22
BmrFI CCNGG 1 cut(s) 190
BpuMI CCSGG 1 cut(s) 190
BsaXI ACNNNNNCTCC 2 cut(s) 217, 247
Bsc4I CCNNNNNNNGG 3 cut(s) 118, 140, 195
BseLI CCNNNNNNNGG 3 cut(s) 118, 140, 195
BseRI GAGGAG 3 cut(s) 19, 156, 208
BshFI GGCC 1 cut(s) 99
BsiHKAI GWGCWC 1 cut(s) 126
BsiHKCI CYCGRG 1 cut(s) 22
BsiSI CCGG 1 cut(s) 190
BslI CCNNNNNNNGG 3 cut(s) 118, 140, 195
BsmAI GTCTC 1 cut(s) 25
BsnI GGCC 1 cut(s) 99
BsoBI CYCGRG 1 cut(s) 22
Bsp1286I GDGCHC 1 cut(s) 126
BspANI GGCC 1 cut(s) 99
BspQI GCTCTTC 1 cut(s) 194
Bst6I CTCTTC 1 cut(s) 194
BstC8I GCNNGC 1 cut(s) 206
BstMAI GTCTC 1 cut(s) 25
BstMWI GCNNNNNNNGC 1 cut(s) 214
BstNSI RCATGY 2 cut(s) 20, 217
BstSCI CCNGG 1 cut(s) 188
BsuRI GGCC 1 cut(s) 99
Cac8I GCNNGC 1 cut(s) 206
CviAII CATG 3 cut(s) 17, 214, 250
CviJI RGCY 6 cut(s) 27, 67, 99, 160, 172, 208
CviKI_1 RGCY 6 cut(s) 27, 67, 99, 160, 172, 208
Eam1104I CTCTTC 1 cut(s) 194
EarI CTCTTC 1 cut(s) 194
Eco57I CTGAAG 1 cut(s) 194
Eco88I CYCGRG 1 cut(s) 22
FaeI CATG 3 cut(s) 20, 217, 253
FaiI YATR 7 cut(s) 18, 56, 151, 164, 215, 241, 251
FatI CATG 3 cut(s) 16, 213, 249
FspBI CTAG 1 cut(s) 209
HaeIII GGCC 1 cut(s) 99
HapII CCGG 1 cut(s) 190
Hin1II CATG 3 cut(s) 20, 217, 253
HindIII AAGCTT 1 cut(s) 65
HpaII CCGG 1 cut(s) 190
Hpy188I TCNGA 1 cut(s) 37
Hpy188III TCNNGA 2 cut(s) 22, 134
Hpy99I CGWCG 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 243
HpyF10VI GCNNNNNNNGC 1 cut(s) 214
HpySE526I ACGT 1 cut(s) 243
Hsp92II CATG 3 cut(s) 20, 217, 253
LguI GCTCTTC 1 cut(s) 194
LmnI GCTCC 1 cut(s) 129
LpnPI CCDG 4 cut(s) 104, 140, 147, 203
MaeI CTAG 1 cut(s) 209
MaeII ACGT 1 cut(s) 243
MboII GAAGA 2 cut(s) 73, 211
MhlI GDGCHC 1 cut(s) 126
MmeI TCCRAC 1 cut(s) 102
MnlI CCTC 7 cut(s) 83, 110, 134, 137, 186, 189, 221
MseI TTAA 1 cut(s) 180
MspI CCGG 1 cut(s) 190
MspR9I CCNGG 1 cut(s) 190
MwoI GCNNNNNNNGC 1 cut(s) 214
NciI CCSGG 1 cut(s) 190
NlaIII CATG 3 cut(s) 20, 217, 253
NspI RCATGY 2 cut(s) 20, 217
PaeR7I CTCGAG 1 cut(s) 22
PciSI GCTCTTC 1 cut(s) 194
PflMI CCANNNNNTGG 1 cut(s) 118
SapI GCTCTTC 1 cut(s) 194
SaqAI TTAA 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 190
SduI GDGCHC 1 cut(s) 126
SetI ASST 6 cut(s) 69, 75, 148, 162, 210, 246
Sfr274I CTCGAG 1 cut(s) 22
SlaI CTCGAG 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
SspMI CTAG 1 cut(s) 209
StyD4I CCNGG 1 cut(s) 188
TaiI ACGT 1 cut(s) 246
TaqI TCGA 1 cut(s) 23
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TspDTI ATGAA 1 cut(s) 138
Van91I CCANNNNNTGG 1 cut(s) 118
XceI RCATGY 2 cut(s) 20, 217
XhoI CTCGAG 1 cut(s) 22
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.