Rroxscaffold_7G00165210

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
7056908 .. 7058253
1346 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00165210.1

Sequence Viewer

Length: 207 bp
ATGGAGTATCATAAAGAAGGCTCGAGAACCACCTACTATGAACCTGAAGAGCCCCAAATCGGAGATTGTTGCCGGATGGAGCGAGCACGAGGGTCTGATATCTTGCTAGATGAAATCTCGGAGGTAAAAATCAACTTCACTGTAGAAAGTGAAATTGTCGTTTTGGTTTTGGGGTTTTGGTCCTCCAATGTTGTCTTTTATGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.91

Weight (kDa)

4.44

Isoelectric Point (pI)

52.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 66
AfiI CCNNNNNNNGG 1 cut(s) 59
Alw21I GWGCWC 1 cut(s) 88
Ama87I CYCGRG 1 cut(s) 22
AspS9I GGNCC 1 cut(s) 180
AvaI CYCGRG 1 cut(s) 22
AvaII GGWCC 1 cut(s) 180
BanII GRGCYC 1 cut(s) 54
BauI CACGAG 1 cut(s) 87
Bbv12I GWGCWC 1 cut(s) 88
BccI CCATC 1 cut(s) 70
BfaI CTAG 1 cut(s) 107
BfmI CTRYAG 1 cut(s) 141
Bme18I GGWCC 1 cut(s) 180
BmeT110I CYCGRG 1 cut(s) 22
BmgT120I GGNCC 1 cut(s) 180
Bsc4I CCNNNNNNNGG 1 cut(s) 59
BseGI GGATG 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 59
BsiHKAI GWGCWC 1 cut(s) 88
BsiHKCI CYCGRG 1 cut(s) 22
BsiSI CCGG 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 59
BsoBI CYCGRG 1 cut(s) 22
Bsp1286I GDGCHC 2 cut(s) 54, 88
BspQI GCTCTTC 1 cut(s) 42
BssSI CACGAG 1 cut(s) 87
Bst2BI CACGAG 1 cut(s) 87
Bst4CI ACNGT 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 84
BstF5I GGATG 1 cut(s) 81
BstSFI CTRYAG 1 cut(s) 141
BtsCI GGATG 1 cut(s) 81
BtsIMutI CAGTG 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 180
CviJI RGCY 2 cut(s) 21, 52
CviKI_1 RGCY 2 cut(s) 21, 52
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
Eco24I GRGCYC 1 cut(s) 54
Eco32I GATATC 1 cut(s) 100
Eco47I GGWCC 1 cut(s) 180
Eco57I CTGAAG 1 cut(s) 66
Eco88I CYCGRG 1 cut(s) 22
EcoRV GATATC 1 cut(s) 100
EcoT38I GRGCYC 1 cut(s) 54
FaiI YATR 3 cut(s) 12, 39, 201
FokI GGATG 1 cut(s) 88
FriOI GRGCYC 1 cut(s) 54
FspBI CTAG 1 cut(s) 107
HapII CCGG 1 cut(s) 73
HpaII CCGG 1 cut(s) 73
Hpy188I TCNGA 3 cut(s) 62, 97, 121
Hpy188III TCNNGA 1 cut(s) 24
HpyAV CCTTC 1 cut(s) 11
HpyCH4III ACNGT 1 cut(s) 142
LguI GCTCTTC 1 cut(s) 42
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 57, 86
MaeI CTAG 1 cut(s) 107
MboII GAAGA 1 cut(s) 59
MhlI GDGCHC 2 cut(s) 54, 88
MluCI AATT 1 cut(s) 153
MnlI CCTC 3 cut(s) 83, 115, 193
MspI CCGG 1 cut(s) 73
PaeR7I CTCGAG 1 cut(s) 22
PciSI GCTCTTC 1 cut(s) 42
PspPI GGNCC 1 cut(s) 180
SapI GCTCTTC 1 cut(s) 42
Sau96I GGNCC 1 cut(s) 180
SduI GDGCHC 2 cut(s) 54, 88
SetI ASST 3 cut(s) 35, 46, 126
SfcI CTRYAG 1 cut(s) 141
Sfr274I CTCGAG 1 cut(s) 22
SinI GGWCC 1 cut(s) 180
SlaI CTCGAG 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 1 cut(s) 153
SspMI CTAG 1 cut(s) 107
TaaI ACNGT 1 cut(s) 142
TaqI TCGA 1 cut(s) 23
TasI AATT 1 cut(s) 153
TscAI CASTG 1 cut(s) 145
TspDTI ATGAA 2 cut(s) 54, 126
TspRI CASTG 1 cut(s) 145
VpaK11BI GGWCC 1 cut(s) 180
XhoI CTCGAG 1 cut(s) 22
XspI CTAG 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.