Rmu_ssc0000204.1_g000027

S-adenosylmethionine-dependent methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000204.1
OG0008919
Physical Location & Seq
Reverse (-)
143602 .. 145604
2003 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1068 bp
atgccaatgaacggtggaaacggcactcacagctactccaagaactcctactaccagaaaaaagctgcagagattgaaaaggtaaagatcatggaggtgattgctgagaagcttgatatgaaaaacctctcctcaatgtcaagcactattcgtattgcagacttgggatgttcaactgggccaaacactttcgtgacaatgcaaaacatactagaagccatgcaacaaaagtaccgaccccaatctgctcctgatgatcatcaaacaatgcctgaatttcaagtgttcttcaacgacctagtgttgaatgacttcaataccctgtttacctctcttcccaaaggcaagcaatactttgcagcaggggtaccggggtcttttcacgaccgtttgtttccggagtcctctatccaccttgtgcacgcctcactttccctccactggctctctaagttgccagaagagttgcaagacaaggcctctccagcatggaacaaagggaggattcactacacaagtgcccctaatgaagtggttgatgcttacatgtcccagtttgccaaggaaatggagaactttctggatgcgagggctaaagagcttgtgcctggaggaatgatggtgatggtcttgtctggaaatcataaaggcatgccttattctcaaaccgcatccggcatgatgtacgatgcgatatcatcgagcctcatggatatggaaaaagagggattgattgatgaaggtcaagtggatgctttcaacttgcctttctacgctgcctcactggaggagttggaggggcttgtggttaaaaatgggtgctttagcattgagaggatggagtcttcaaacccagcagcatggatgaaaggtccacttgacataacacaatgggtgatgcatatacgggctgcaatggaaggaatgttcgccggacattttggaagtcatgaggttatggatcaaatgttccaacgttcggctcaaaagctttcagacaagtctgaccttataaactcaaggtgccacgagcaaagtcagctgcttgctgttctcaagcgtaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_7

Protein Analysis

355

Amino Acids

39.78

Weight (kDa)

5.75

Isoelectric Point (pI)

49.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_7 PF03492 42 - 354 4.2e-107 SAM dependent carboxyl methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1013
Acc65I GGTACC 1 cut(s) 367
AccB1I GGYRCC 2 cut(s) 367, 1023
AccIII TCCGGA 1 cut(s) 397
AciI CCGC 1 cut(s) 669
AclI AACGTT 1 cut(s) 976
AclWI GGATC 1 cut(s) 969
AcsI RAATTY 1 cut(s) 275
AdeI CACNNNGTG 1 cut(s) 418
AfaI GTAC 3 cut(s) 233, 369, 686
AfiI CCNNNNNNNGG 3 cut(s) 11, 441, 979
AflIII ACRYGT 1 cut(s) 546
AgsI TTSAA 8 cut(s) 77, 174, 281, 292, 307, 316, 760, 849
AjnI CCWGG 1 cut(s) 607
AleI CACNNNNGTG 1 cut(s) 191
AloI GAACNNNNNNTCC 4 cut(s) 911, 943, 953, 985
AluBI AGCT 6 cut(s) 33, 65, 112, 601, 991, 1042
AluI AGCT 6 cut(s) 33, 65, 112, 601, 991, 1042
Alw21I GWGCWC 1 cut(s) 423
Alw44I GTGCAC 1 cut(s) 419
AlwI GGATC 1 cut(s) 969
Aor13HI TCCGGA 1 cut(s) 397
AoxI GGCC 2 cut(s) 179, 477
ApaLI GTGCAC 1 cut(s) 419
ApeKI GCWGC 6 cut(s) 65, 359, 776, 857, 911, 1042
ApoI RAATTY 1 cut(s) 275
Asp700I GAANNNNTTC 1 cut(s) 311
Asp718I GGTACC 1 cut(s) 367
AspS9I GGNCC 2 cut(s) 179, 872
AsuC2I CCSGG 1 cut(s) 372
AsuHPI GGTGA 3 cut(s) 109, 634, 907
AvaII GGWCC 1 cut(s) 872
BaeGI GKGCMC 2 cut(s) 423, 523
BaeI ACNNNNGTAYC 4 cut(s) 215, 248, 359, 392
BanI GGYRCC 2 cut(s) 367, 1023
BauI CACGAG 1 cut(s) 1028
BbsI GAAGAC 1 cut(s) 837
Bbv12I GWGCWC 1 cut(s) 423
BbvI GCAGC 6 cut(s) 52, 371, 763, 869, 898, 1029
BccI CCATC 3 cut(s) 613, 619, 832
BceAI ACGGC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 609
BclI TGATCA 1 cut(s) 256
BcnI CCSGG 1 cut(s) 372
BfaI CTAG 2 cut(s) 212, 299
BfmI CTRYAG 1 cut(s) 66
BisI GCNGC 6 cut(s) 66, 360, 777, 858, 912, 1043
BlsI GCNGC 6 cut(s) 67, 361, 778, 859, 913, 1044
Bme1390I CCNGG 2 cut(s) 372, 609
Bme18I GGWCC 1 cut(s) 872
BmgT120I GGNCC 2 cut(s) 179, 872
BmiI GGNNCC 2 cut(s) 369, 1025
BmrFI CCNGG 2 cut(s) 372, 609
BmrI ACTGGG 2 cut(s) 186, 547
BmsI GCATC 6 cut(s) 529, 574, 679, 680, 742, 888
BmuI ACTGGG 2 cut(s) 186, 547
BpiI GAAGAC 1 cut(s) 837
BpmI CTGGAG 3 cut(s) 468, 630, 806
BpuEI CTTGAG 2 cut(s) 1003, 1040
BpuMI CCSGG 1 cut(s) 372
BsaBI GATNNNNATC 1 cut(s) 258
BsaJI CCNNGG 2 cut(s) 371, 561
BsaWI WCCGGW 1 cut(s) 397
BsaXI ACNNNNNCTCC 4 cut(s) 20, 50, 420, 450
Bsc4I CCNNNNNNNGG 3 cut(s) 11, 441, 979
Bse1I ACTGG 4 cut(s) 181, 446, 553, 789
Bse3DI GCAATG 1 cut(s) 921
Bse8I GATNNNNATC 1 cut(s) 258
BseAI TCCGGA 1 cut(s) 397
BseBI CCWGG 1 cut(s) 609
BseDI CCNNGG 2 cut(s) 371, 561
BseGI GGATG 6 cut(s) 173, 589, 671, 757, 843, 870
BseJI GATNNNNATC 1 cut(s) 258
BseLI CCNNNNNNNGG 3 cut(s) 11, 441, 979
BseMI GCAATG 1 cut(s) 921
BseMII CTCAG 1 cut(s) 96
BseNI ACTGG 4 cut(s) 181, 446, 553, 789
BseRI GAGGAG 2 cut(s) 121, 803
BseSI GKGCMC 2 cut(s) 423, 523
BseXI GCAGC 6 cut(s) 52, 371, 763, 869, 898, 1029
BseYI CCCAGC 1 cut(s) 853
Bsh1285I CGRYCG 1 cut(s) 388
BshFI GGCC 2 cut(s) 181, 479
BshNI GGYRCC 2 cut(s) 367, 1023
BsiEI CGRYCG 1 cut(s) 388
BsiHKAI GWGCWC 1 cut(s) 423
BsiSI CCGG 4 cut(s) 371, 398, 675, 933
BslFI GGGAC 1 cut(s) 535
BslI CCNNNNNNNGG 3 cut(s) 11, 441, 979
BsmFI GGGAC 1 cut(s) 535
BsnI GGCC 2 cut(s) 181, 479
Bsp1286I GDGCHC 2 cut(s) 423, 523
Bsp13I TCCGGA 1 cut(s) 397
Bsp143I GATC 3 cut(s) 87, 256, 961
BspACI CCGC 1 cut(s) 669
BspANI GGCC 2 cut(s) 181, 479
BspCNI CTCAG 1 cut(s) 97
BspEI TCCGGA 1 cut(s) 397
BspHI TCATGA 1 cut(s) 949
BspLI GGNNCC 2 cut(s) 369, 1025
BspMAI CTGCAG 1 cut(s) 70
BspPI GGATC 1 cut(s) 969
BspT107I GGYRCC 2 cut(s) 367, 1023
BsrDI GCAATG 1 cut(s) 921
BsrI ACTGG 4 cut(s) 181, 446, 553, 789
BssECI CCNNGG 2 cut(s) 371, 561
BssMI GATC 3 cut(s) 87, 256, 961
BssSI CACGAG 1 cut(s) 1028
BssT1I CCWWGG 1 cut(s) 561
Bst2BI CACGAG 1 cut(s) 1028
Bst2UI CCWGG 1 cut(s) 609
Bst4CI ACNGT 2 cut(s) 14, 389
Bst6I CTCTTC 2 cut(s) 339, 456
BstC8I GCNNGC 4 cut(s) 347, 423, 653, 1047
BstDEI CTNAG 2 cut(s) 105, 450
BstF5I GGATG 6 cut(s) 173, 589, 671, 757, 843, 870
BstKTI GATC 3 cut(s) 90, 259, 964
BstMBI GATC 3 cut(s) 87, 256, 961
BstMCI CGRYCG 1 cut(s) 388
BstMWI GCNNNNNNNGC 3 cut(s) 30, 485, 1039
BstNI CCWGG 1 cut(s) 609
BstNSI RCATGY 2 cut(s) 550, 655
BstSCI CCNGG 2 cut(s) 370, 607
BstSFI CTRYAG 1 cut(s) 66
BstSLI GKGCMC 2 cut(s) 423, 523
BstV1I GCAGC 6 cut(s) 52, 371, 763, 869, 898, 1029
BstV2I GAAGAC 1 cut(s) 837
BstXI CCANNNNNNTGG 2 cut(s) 568, 861
BsuRI GGCC 2 cut(s) 181, 479
BtsCI GGATG 6 cut(s) 173, 589, 671, 757, 843, 870
BtsIMutI CAGTG 2 cut(s) 439, 782
Cac8I GCNNGC 4 cut(s) 347, 423, 653, 1047
CciI TCATGA 1 cut(s) 949
Cfr13I GGNCC 2 cut(s) 179, 872
Csp6I GTAC 3 cut(s) 232, 368, 685
CviAII CATG 9 cut(s) 91, 220, 489, 547, 652, 679, 709, 861, 950
CviQI GTAC 3 cut(s) 232, 368, 685
DdeI CTNAG 2 cut(s) 105, 450
DpnI GATC 3 cut(s) 89, 258, 963
DpnII GATC 3 cut(s) 87, 256, 961
DraIII CACNNNGTG 1 cut(s) 418
Eam1104I CTCTTC 2 cut(s) 339, 456
EarI CTCTTC 2 cut(s) 339, 456
Eco130I CCWWGG 1 cut(s) 561
Eco147I AGGCCT 1 cut(s) 479
Eco32I GATATC 1 cut(s) 696
Eco47I GGWCC 1 cut(s) 872
EcoRII CCWGG 1 cut(s) 607
EcoRV GATATC 1 cut(s) 696
EcoT14I CCWWGG 1 cut(s) 561
EcoT22I ATGCAT 1 cut(s) 903
ErhI CCWWGG 1 cut(s) 561
FaeI CATG 9 cut(s) 94, 223, 492, 550, 655, 682, 712, 864, 953
FalI AAGNNNNNCTT 4 cut(s) 338, 370, 861, 893
FaqI GGGAC 1 cut(s) 535
FatI CATG 9 cut(s) 90, 219, 488, 546, 651, 678, 708, 860, 949
FbaI TGATCA 1 cut(s) 256
Fnu4HI GCNGC 6 cut(s) 66, 360, 777, 858, 912, 1043
FokI GGATG 6 cut(s) 180, 596, 658, 764, 850, 877
Fsp4HI GCNGC 6 cut(s) 66, 360, 777, 858, 912, 1043
FspBI CTAG 2 cut(s) 212, 299
GluI GCNGC 6 cut(s) 66, 360, 777, 858, 912, 1043
GsaI CCCAGC 1 cut(s) 857
GsuI CTGGAG 3 cut(s) 468, 630, 806
HaeIII GGCC 2 cut(s) 181, 479
HapII CCGG 4 cut(s) 371, 398, 675, 933
Hin1II CATG 9 cut(s) 94, 223, 492, 550, 655, 682, 712, 864, 953
HindIII AAGCTT 2 cut(s) 110, 989
HinfI GANTC 3 cut(s) 401, 505, 842
HpaII CCGG 4 cut(s) 371, 398, 675, 933
HphI GGTGA 3 cut(s) 109, 634, 907
Hpy166II GTNNAC 3 cut(s) 327, 421, 875
Hpy188I TCNGA 2 cut(s) 997, 1006
Hpy188III TCNNGA 7 cut(s) 193, 251, 383, 398, 581, 636, 950
Hpy8I GTNNAC 3 cut(s) 327, 421, 875
HpyAV CCTTC 2 cut(s) 734, 914
HpyCH4III ACNGT 2 cut(s) 14, 389
HpyCH4IV ACGT 1 cut(s) 976
HpyCH4V TGCA 9 cut(s) 68, 158, 202, 223, 359, 421, 469, 901, 914
HpyF10VI GCNNNNNNNGC 3 cut(s) 30, 485, 1039
HpyF3I CTNAG 2 cut(s) 105, 450
HpySE526I ACGT 1 cut(s) 976
Hsp92II CATG 9 cut(s) 94, 223, 492, 550, 655, 682, 712, 864, 953
Kpn2I TCCGGA 1 cut(s) 397
KpnI GGTACC 1 cut(s) 371
Ksp22I TGATCA 1 cut(s) 256
Kzo9I GATC 3 cut(s) 87, 256, 961
LmnI GCTCC 1 cut(s) 253
Lsp1109I GCAGC 6 cut(s) 52, 371, 763, 869, 898, 1029
LweI GCATC 6 cut(s) 529, 574, 679, 680, 742, 888
MaeI CTAG 2 cut(s) 212, 299
MaeII ACGT 1 cut(s) 976
MaeIII GTNAC 1 cut(s) 193
MalI GATC 3 cut(s) 89, 258, 963
MboI GATC 3 cut(s) 87, 256, 961
MboII GAAGA 4 cut(s) 280, 326, 473, 837
MhlI GDGCHC 2 cut(s) 423, 523
MluCI AATT 1 cut(s) 275
MlyI GAGTC 2 cut(s) 410, 851
MmeI TCCRAC 2 cut(s) 774, 997
Mph1103I ATGCAT 1 cut(s) 903
MroI TCCGGA 1 cut(s) 397
MroXI GAANNNNTTC 1 cut(s) 311
MseI TTAA 1 cut(s) 810
MslI CAYNNNNRTG 3 cut(s) 95, 191, 713
MspA1I CMGCKG 1 cut(s) 1042
MspI CCGG 4 cut(s) 371, 398, 675, 933
MspR9I CCNGG 2 cut(s) 372, 609
MvaI CCWGG 1 cut(s) 609
MwoI GCNNNNNNNGC 3 cut(s) 30, 485, 1039
NciI CCSGG 1 cut(s) 372
NdeII GATC 3 cut(s) 87, 256, 961
NlaIII CATG 9 cut(s) 94, 223, 492, 550, 655, 682, 712, 864, 953
NlaIV GGNNCC 2 cut(s) 369, 1025
NmuCI GTSAC 1 cut(s) 193
NsiI ATGCAT 1 cut(s) 903
NspI RCATGY 2 cut(s) 550, 655
OliI CACNNNNGTG 1 cut(s) 191
PaeI GCATGC 1 cut(s) 655
PagI TCATGA 1 cut(s) 949
PceI AGGCCT 1 cut(s) 479
PciI ACATGT 1 cut(s) 546
PdmI GAANNNNTTC 1 cut(s) 311
PfeI GAWTC 1 cut(s) 505
PkrI GCNGC 6 cut(s) 67, 361, 778, 859, 913, 1044
PleI GAGTC 2 cut(s) 409, 850
PpsI GAGTC 2 cut(s) 409, 850
PscI ACATGT 1 cut(s) 546
PsiI TTATAA 1 cut(s) 1013
Psp1406I AACGTT 1 cut(s) 976
Psp6I CCWGG 1 cut(s) 607
PspFI CCCAGC 1 cut(s) 853
PspGI CCWGG 1 cut(s) 607
PspN4I GGNNCC 2 cut(s) 369, 1025
PspPI GGNCC 2 cut(s) 179, 872
PsrI GAACNNNNNNTAC 2 cut(s) 35, 67
PstI CTGCAG 1 cut(s) 70
PvuII CAGCTG 1 cut(s) 1042
RsaI GTAC 3 cut(s) 233, 369, 686
RsaNI GTAC 3 cut(s) 232, 368, 685
RseI CAYNNNNRTG 3 cut(s) 95, 191, 713
SaqAI TTAA 1 cut(s) 810
SatI GCNGC 6 cut(s) 66, 360, 777, 858, 912, 1043
Sau3AI GATC 3 cut(s) 87, 256, 961
Sau96I GGNCC 2 cut(s) 179, 872
SchI GAGTC 2 cut(s) 410, 851
ScrFI CCNGG 2 cut(s) 372, 609
SduI GDGCHC 2 cut(s) 423, 523
SfaNI GCATC 6 cut(s) 529, 574, 679, 680, 742, 888
SfcI CTRYAG 1 cut(s) 66
SinI GGWCC 1 cut(s) 872
SmiMI CAYNNNNRTG 3 cut(s) 95, 191, 713
SmlI CTYRAG 2 cut(s) 1018, 1055
SmoI CTYRAG 2 cut(s) 1018, 1055
SphI GCATGC 1 cut(s) 655
Sse9I AATT 1 cut(s) 275
SseBI AGGCCT 1 cut(s) 479
SsiI CCGC 1 cut(s) 669
SspMI CTAG 2 cut(s) 212, 299
StuI AGGCCT 1 cut(s) 479
StyD4I CCNGG 2 cut(s) 370, 607
StyI CCWWGG 1 cut(s) 561
TaaI ACNGT 2 cut(s) 14, 389
TaiI ACGT 1 cut(s) 979
TaqI TCGA 1 cut(s) 701
TasI AATT 1 cut(s) 275
TfiI GAWTC 1 cut(s) 505
Tru1I TTAA 1 cut(s) 810
Tru9I TTAA 1 cut(s) 810
TscAI CASTG 2 cut(s) 446, 789
TseFI GTSAC 1 cut(s) 193
TseI GCWGC 6 cut(s) 65, 359, 776, 857, 911, 1042
Tsp45I GTSAC 1 cut(s) 193
TspDTI ATGAA 5 cut(s) 23, 134, 543, 753, 881
TspRI CASTG 2 cut(s) 446, 789
VneI GTGCAC 1 cut(s) 419
VpaK11BI GGWCC 1 cut(s) 872
XapI RAATTY 1 cut(s) 275
XceI RCATGY 2 cut(s) 550, 655
XmnI GAANNNNTTC 1 cut(s) 311
XspI CTAG 2 cut(s) 212, 299
Zsp2I ATGCAT 1 cut(s) 903
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.