Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000301.1

Orthogroup ID

OG0003346

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 3446

Gene Structure 3446 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000301.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 873 bp

gtgaacagaatcagggaactcccacagaatagtaagattgtggccacacacactgacagtcctgatgttctcatttgggacattgaggctcaacctaatcgtcatgctgtcctgggagctacaaattctcgcccagatctgctattgactggacatcaagataatgctgaatttgcacttgctatgtgcccctcggaaccctttgtactctctggagggaaggacaagtcagtgattttgtggagtattcaagatcatatctcgtctttggcatcagatcctgggtctgcaaggtctccaggatctggtggttcaaatgctaaacatgcctctaaggttggtgggagtaatgacaaacccacagacagcccttctgttgagccacgaggtatatatcaagggcatgaggatactgttgaagatgtacagttctgcccatctagtgcgcaggagttctgcagtgtaggcgacgattcttgcctcatactatgggatgctagatctggcaatagtccggttgtcaaggttgagaaagctcatgatgctgaccttcattgtgtagattggaatcctcatgatgtcaatctcattcttacagggtctgctgataagactgttcgtatgtttgaccgccggaatctcacttctggaggagttggatcacccattcataagtttgagggccacaacgaagctgttctctgtgttcagtggtctcctgacaagtcctctgtctttggaagttctgctgaggatggcctattgaacatctgggatcatgaaaagattggtaagaagcaagaatctgttggatcaaagctgccaaatgctcctcctgcaggattgtttttccgacatgctggtcataggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04218 map04218

Pfam Domains

Protein Families

CAF1C_H4-bd WD40

Protein Analysis

290

Amino Acids

31.2

Weight (kDa)

5.64

Isoelectric Point (pI)

52.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003346)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G19520 AT4G29730 AT4G29730 AT4G29730
fragaria_vesca	FvH4_1g07500 FvH4_6g33340 FvH4_6g33340
malus_domestica	MD02G1079600.v1.1 MD09G1193500.v1.1 MD15G1207100.v1.1
prunus_persica	Prupe.3G049900_v2.0.a1 Prupe.7G209600_v2.0.a1 Prupe.7G209600_v2.0.a1
pyrus_communis	pycom02g06340 pycom09g11000 pycom15g18350
rosa_chinensis	RchiOBHm_Chr2g0093391 RchiOBHm_Chr2g0143191
rosa_laevigata	RLG00000016395 RLG00000020012
rosa_multiflora	Rmu_sc0005227.1_g000015 Rmu_sc0032382.1_g000001 Rmu_ssc0000301.1_g000001
rosa_roxburghii	Rroxscaffold_2G00102060 Rroxscaffold_2G00148140
rosa_rugosa	Rorug02G0035100 Rorug02G0379000
rosa_samantha	Rh2AG431800 Rh2BG082700 Rh2BG440400 Rh2CG084700 Rh2CG417700 Rh2DG080400 Rh2DG450600
rosa_wichuraiana	Rw2G006520 Rw2G035280

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	861
Acc16I	TGCGCA	1 cut(s)	447
AccB7I	CCANNNNNTGG	1 cut(s)	305
AciI	CCGC	1 cut(s)	631
AclWI	GGATC	5 cut(s)	272, 310, 667, 783, 820
AcoI	YGGCCR	1 cut(s)	42
AcsI	RAATTY	2 cut(s)	124, 170
AfaI	GTAC	2 cut(s)	207, 426
AfiI	CCNNNNNNNGG	2 cut(s)	305, 839
AgsI	TTSAA	4 cut(s)	251, 315, 419, 766
AjnI	CCWGG	3 cut(s)	111, 280, 298
AluBI	AGCT	4 cut(s)	119, 536, 695, 820
AluI	AGCT	4 cut(s)	119, 536, 695, 820
Alw26I	GTCTC	2 cut(s)	300, 720
AlwI	GGATC	5 cut(s)	272, 310, 667, 783, 820
AlwNI	CAGNNNCTG	3 cut(s)	281, 305, 602
AoxI	GGCC	3 cut(s)	42, 682, 757
ApeKI	GCWGC	1 cut(s)	820
ApoI	RAATTY	2 cut(s)	124, 170
Asp700I	GAANNNNTTC	1 cut(s)	696
AspLEI	GCGC	1 cut(s)	448
AspS9I	GGNCC	1 cut(s)	682
AsuHPI	GGTGA	1 cut(s)	654
BaeGI	GKGCMC	1 cut(s)	191
BalI	TGGCCA	1 cut(s)	44
BauI	CACGAG	1 cut(s)	384
BbvCI	CCTCAGC	1 cut(s)	750
BbvI	GCAGC	1 cut(s)	807
BccI	CCATC	2 cut(s)	445, 749
BciT130I	CCWGG	3 cut(s)	113, 282, 300
BciVI	GTATCC	1 cut(s)	403
BcoDI	GTCTC	2 cut(s)	300, 720
BfaI	CTAG	2 cut(s)	441, 498
BfmI	CTRYAG	2 cut(s)	457, 837
BfuI	GTATCC	1 cut(s)	403
BglII	AGATCT	2 cut(s)	136, 500
BisI	GCNGC	1 cut(s)	821
BlsI	GCNGC	1 cut(s)	822
Bme1390I	CCNGG	3 cut(s)	113, 282, 300
BmgT120I	GGNCC	1 cut(s)	682
BmiI	GGNNCC	1 cut(s)	198
BmrFI	CCNGG	3 cut(s)	113, 282, 300
BmsI	GCATC	3 cut(s)	281, 484, 532
BpmI	CTGGAG	3 cut(s)	234, 282, 669
Bpu10I	CCTNAGC	1 cut(s)	750
BsaBI	GATNNNNATC	2 cut(s)	567, 582
BsaI	GGTCTC	2 cut(s)	300, 720
BsaJI	CCNNGG	3 cut(s)	112, 192, 281
BsaWI	WCCGGW	1 cut(s)	514
Bsc4I	CCNNNNNNNGG	2 cut(s)	305, 839
Bse1I	ACTGG	1 cut(s)	154
Bse8I	GATNNNNATC	2 cut(s)	567, 582
BseBI	CCWGG	3 cut(s)	113, 282, 300
BseDI	CCNNGG	3 cut(s)	112, 192, 281
BseGI	GGATG	2 cut(s)	499, 760
BseJI	GATNNNNATC	2 cut(s)	567, 582
BseLI	CCNNNNNNNGG	2 cut(s)	305, 839
BseMII	CTCAG	1 cut(s)	741
BseNI	ACTGG	1 cut(s)	154
BseRI	GAGGAG	2 cut(s)	666, 822
BseSI	GKGCMC	1 cut(s)	191
BseXI	GCAGC	1 cut(s)	807
BshFI	GGCC	3 cut(s)	44, 684, 759
BsiSI	CCGG	2 cut(s)	515, 634
BslFI	GGGAC	1 cut(s)	92
BslI	CCNNNNNNNGG	2 cut(s)	305, 839
BsmAI	GTCTC	2 cut(s)	300, 720
BsmFI	GGGAC	1 cut(s)	92
BsnI	GGCC	3 cut(s)	44, 684, 759
Bso31I	GGTCTC	2 cut(s)	300, 720
Bsp1286I	GDGCHC	1 cut(s)	191
Bsp1407I	TGTACA	1 cut(s)	424
Bsp143I	GATC	8 cut(s)	136, 253, 277, 302, 500, 659, 775, 812
BspACI	CCGC	1 cut(s)	631
BspANI	GGCC	3 cut(s)	44, 684, 759
BspCNI	CTCAG	1 cut(s)	742
BspHI	TCATGA	3 cut(s)	538, 574, 778
BspLI	GGNNCC	1 cut(s)	198
BspMAI	CTGCAG	2 cut(s)	461, 841
BspPI	GGATC	5 cut(s)	272, 310, 667, 783, 820
BspTNI	GGTCTC	2 cut(s)	300, 720
BsrGI	TGTACA	1 cut(s)	424
BsrI	ACTGG	1 cut(s)	154
BssECI	CCNNGG	3 cut(s)	112, 192, 281
BssMI	GATC	8 cut(s)	136, 253, 277, 302, 500, 659, 775, 812
BssSI	CACGAG	1 cut(s)	384
Bst2BI	CACGAG	1 cut(s)	384
Bst2UI	CCWGG	3 cut(s)	113, 282, 300
Bst4CI	ACNGT	4 cut(s)	59, 415, 429, 616
BstAUI	TGTACA	1 cut(s)	424
BstDEI	CTNAG	2 cut(s)	333, 750
BstENI	CCTNNNNNAGG	1 cut(s)	837
BstF5I	GGATG	2 cut(s)	499, 760
BstHHI	GCGC	1 cut(s)	448
BstKTI	GATC	8 cut(s)	139, 256, 280, 305, 503, 662, 778, 815
BstMAI	GTCTC	2 cut(s)	300, 720
BstMBI	GATC	8 cut(s)	136, 253, 277, 302, 500, 659, 775, 812
BstMWI	GCNNNNNNNGC	5 cut(s)	173, 326, 465, 542, 836
BstNI	CCWGG	3 cut(s)	113, 282, 300
BstNSI	RCATGY	2 cut(s)	329, 860
BstSCI	CCNGG	3 cut(s)	111, 280, 298
BstSFI	CTRYAG	2 cut(s)	457, 837
BstSLI	GKGCMC	1 cut(s)	191
BstV1I	GCAGC	1 cut(s)	807
BstX2I	RGATCY	4 cut(s)	136, 277, 302, 500
BstYI	RGATCY	4 cut(s)	136, 277, 302, 500
BsuI	GTATCC	1 cut(s)	403
BsuRI	GGCC	3 cut(s)	44, 684, 759
BtsCI	GGATG	2 cut(s)	499, 760
BtsI	GCAGTG	1 cut(s)	466
BtsIMutI	CAGTG	4 cut(s)	51, 237, 466, 716
CaiI	CAGNNNCTG	3 cut(s)	281, 305, 602
CciI	TCATGA	3 cut(s)	538, 574, 778
CfoI	GCGC	1 cut(s)	448
Cfr13I	GGNCC	1 cut(s)	682
Csp6I	GTAC	2 cut(s)	206, 425
CviAII	CATG	7 cut(s)	104, 326, 404, 539, 575, 779, 857
CviQI	GTAC	2 cut(s)	206, 425
DdeI	CTNAG	2 cut(s)	333, 750
DpnI	GATC	8 cut(s)	138, 255, 279, 304, 502, 661, 777, 814
DpnII	GATC	8 cut(s)	136, 253, 277, 302, 500, 659, 775, 812
DrdI	GACNNNNNNGTC	1 cut(s)	861
DseDI	GACNNNNNNGTC	1 cut(s)	861
EaeI	YGGCCR	1 cut(s)	42
Eco31I	GGTCTC	2 cut(s)	300, 720
EcoNI	CCTNNNNNAGG	1 cut(s)	837
EcoRII	CCWGG	3 cut(s)	111, 280, 298
FaeI	CATG	7 cut(s)	107, 329, 407, 542, 578, 782, 860
FaqI	GGGAC	1 cut(s)	92
FatI	CATG	7 cut(s)	103, 325, 403, 538, 574, 778, 856
Fnu4HI	GCNGC	1 cut(s)	821
FokI	GGATG	2 cut(s)	506, 767
Fsp4HI	GCNGC	1 cut(s)	821
FspBI	CTAG	2 cut(s)	441, 498
FspI	TGCGCA	1 cut(s)	447
GlaI	GCGC	1 cut(s)	447
GluI	GCNGC	1 cut(s)	821
GsuI	CTGGAG	3 cut(s)	234, 282, 669
HaeIII	GGCC	3 cut(s)	44, 684, 759
HapII	CCGG	2 cut(s)	515, 634
HhaI	GCGC	1 cut(s)	448
Hin1II	CATG	7 cut(s)	107, 329, 407, 542, 578, 782, 860
Hin6I	GCGC	1 cut(s)	446
HinP1I	GCGC	1 cut(s)	446
HinfI	GANTC	5 cut(s)	9, 473, 568, 637, 803
HpaII	CCGG	2 cut(s)	515, 634
HphI	GGTGA	1 cut(s)	654
Hpy166II	GTNNAC	1 cut(s)	4
Hpy188I	TCNGA	3 cut(s)	196, 277, 854
Hpy188III	TCNNGA	9 cut(s)	62, 158, 213, 251, 539, 575, 648, 719, 779
Hpy8I	GTNNAC	1 cut(s)	4
Hpy99I	CGWCG	1 cut(s)	473
HpyAV	CCTTC	3 cut(s)	214, 381, 560
HpyCH4III	ACNGT	4 cut(s)	59, 415, 429, 616
HpyCH4V	TGCA	4 cut(s)	176, 290, 459, 839
HpyF10VI	GCNNNNNNNGC	5 cut(s)	173, 326, 465, 542, 836
HpyF3I	CTNAG	2 cut(s)	333, 750
Hsp92II	CATG	7 cut(s)	107, 329, 407, 542, 578, 782, 860
HspAI	GCGC	1 cut(s)	446
Kzo9I	GATC	8 cut(s)	136, 253, 277, 302, 500, 659, 775, 812
LmnI	GCTCC	2 cut(s)	116, 835
Lsp1109I	GCAGC	1 cut(s)	807
LweI	GCATC	3 cut(s)	281, 484, 532
MaeI	CTAG	2 cut(s)	441, 498
MalI	GATC	8 cut(s)	138, 255, 279, 304, 502, 661, 777, 814
MboI	GATC	8 cut(s)	136, 253, 277, 302, 500, 659, 775, 812
MboII	GAAGA	1 cut(s)	431
MflI	RGATCY	4 cut(s)	136, 277, 302, 500
MhlI	GDGCHC	1 cut(s)	191
MlsI	TGGCCA	1 cut(s)	44
MluCI	AATT	2 cut(s)	124, 170
MluNI	TGGCCA	1 cut(s)	44
MmeI	TCCRAC	2 cut(s)	637, 790
Mox20I	TGGCCA	1 cut(s)	44
MroXI	GAANNNNTTC	1 cut(s)	696
MscI	TGGCCA	1 cut(s)	44
Msp20I	TGGCCA	1 cut(s)	44
MspI	CCGG	2 cut(s)	515, 634
MspR9I	CCNGG	3 cut(s)	113, 282, 300
MvaI	CCWGG	3 cut(s)	113, 282, 300
MwoI	GCNNNNNNNGC	5 cut(s)	173, 326, 465, 542, 836
NdeII	GATC	8 cut(s)	136, 253, 277, 302, 500, 659, 775, 812
NlaIII	CATG	7 cut(s)	107, 329, 407, 542, 578, 782, 860
NlaIV	GGNNCC	1 cut(s)	198
NsbI	TGCGCA	1 cut(s)	447
NspI	RCATGY	2 cut(s)	329, 860
PagI	TCATGA	3 cut(s)	538, 574, 778
PdmI	GAANNNNTTC	1 cut(s)	696
PfeI	GAWTC	5 cut(s)	9, 473, 568, 637, 803
PflMI	CCANNNNNTGG	1 cut(s)	305
PfoI	TCCNGGA	1 cut(s)	298
PkrI	GCNGC	1 cut(s)	822
Psp6I	CCWGG	3 cut(s)	111, 280, 298
PspGI	CCWGG	3 cut(s)	111, 280, 298
PspN4I	GGNNCC	1 cut(s)	198
PspPI	GGNCC	1 cut(s)	682
PsrI	GAACNNNNNNTAC	2 cut(s)	189, 221
PstI	CTGCAG	2 cut(s)	461, 841
PstNI	CAGNNNCTG	3 cut(s)	281, 305, 602
PsuI	RGATCY	4 cut(s)	136, 277, 302, 500
RsaI	GTAC	2 cut(s)	207, 426
RsaNI	GTAC	2 cut(s)	206, 425
SatI	GCNGC	1 cut(s)	821
Sau3AI	GATC	8 cut(s)	136, 253, 277, 302, 500, 659, 775, 812
Sau96I	GGNCC	1 cut(s)	682
SbfI	CCTGCAGG	1 cut(s)	841
ScrFI	CCNGG	3 cut(s)	113, 282, 300
SdaI	CCTGCAGG	1 cut(s)	841
SduI	GDGCHC	1 cut(s)	191
SfaNI	GCATC	3 cut(s)	281, 484, 532
SfcI	CTRYAG	2 cut(s)	457, 837
Sse8387I	CCTGCAGG	1 cut(s)	841
Sse9I	AATT	2 cut(s)	124, 170
SsiI	CCGC	1 cut(s)	631
SspMI	CTAG	2 cut(s)	441, 498
StyD4I	CCNGG	3 cut(s)	111, 280, 298
TaaI	ACNGT	4 cut(s)	59, 415, 429, 616
TasI	AATT	2 cut(s)	124, 170
TatI	WGTACW	2 cut(s)	205, 424
TfiI	GAWTC	5 cut(s)	9, 473, 568, 637, 803
TscAI	CASTG	4 cut(s)	58, 237, 466, 716
TseI	GCWGC	1 cut(s)	820
TspDTI	ATGAA	3 cut(s)	542, 659, 795
TspRI	CASTG	4 cut(s)	58, 237, 466, 716
Van91I	CCANNNNNTGG	1 cut(s)	305
XagI	CCTNNNNNAGG	1 cut(s)	837
XapI	RAATTY	2 cut(s)	124, 170
XceI	RCATGY	2 cut(s)	329, 860
XmnI	GAANNNNTTC	1 cut(s)	696
XspI	CTAG	2 cut(s)	441, 498

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.