Rmu_ssc0000342.1_g000015

GRAM domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000342.1
Physical Location & Seq
Reverse (-)
98774 .. 100178
1405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000342.1_g000015.1.cds

Sequence Viewer

Length: 333 bp
atgaccgacgacgaaggaatgaagctcaaaggctacaatggaaagatagtgcagtctaccttggaagaatgtcgggaggtttttgctacctggataaacatggcacatgaattgttgaagacaaagaaccttgagaaacaagcagagagtattcgcatggttagcatggttcagaaatgtgaagttcatcctacagaggaagcagagacggttcagtcttctgaaaagttttacgagcctagtgataggatacaacagatatctgcatccataaaccctaagcacaaagttagcagtctatttcaagaaagtccgagtatttactccctttaa

Protein Analysis

110

Amino Acids

12.6

Weight (kDa)

5.38

Isoelectric Point (pI)

46.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 214
AccI GTMKAC 1 cut(s) 56
AgsI TTSAA 2 cut(s) 118, 305
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
Alw26I GTCTC 1 cut(s) 200
BbsI GAAGAC 2 cut(s) 125, 210
BciT130I CCWGG 1 cut(s) 91
BciVI GTATCC 1 cut(s) 243
BcoDI GTCTC 1 cut(s) 200
BfaI CTAG 1 cut(s) 240
BfmI CTRYAG 1 cut(s) 192
BfuI GTATCC 1 cut(s) 243
Bme1390I CCNGG 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 91
BmsI GCATC 1 cut(s) 275
BpiI GAAGAC 2 cut(s) 125, 210
Bpu10I CCTNAGC 1 cut(s) 279
BpuEI CTTGAG 1 cut(s) 152
BsaJI CCNNGG 1 cut(s) 60
BseBI CCWGG 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 60
BseGI GGATG 2 cut(s) 187, 266
BsgI GTGCAG 1 cut(s) 71
BsmAI GTCTC 1 cut(s) 200
BsmBI CGTCTC 1 cut(s) 200
BssECI CCNNGG 1 cut(s) 60
BssT1I CCWWGG 1 cut(s) 60
Bst2UI CCWGG 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 279
BstF5I GGATG 2 cut(s) 187, 266
BstMAI GTCTC 1 cut(s) 200
BstMWI GCNNNNNNNGC 1 cut(s) 162
BstNI CCWGG 1 cut(s) 91
BstSCI CCNGG 1 cut(s) 89
BstSFI CTRYAG 1 cut(s) 192
BstV2I GAAGAC 2 cut(s) 125, 210
BsuI GTATCC 1 cut(s) 243
BtsCI GGATG 2 cut(s) 187, 266
CviAII CATG 4 cut(s) 100, 107, 157, 166
CviJI RGCY 3 cut(s) 25, 33, 238
CviKI_1 RGCY 3 cut(s) 25, 33, 238
DdeI CTNAG 1 cut(s) 279
DrdI GACNNNNNNGTC 1 cut(s) 214
DseDI GACNNNNNNGTC 1 cut(s) 214
Eco130I CCWWGG 1 cut(s) 60
Eco32I GATATC 1 cut(s) 261
EcoRII CCWGG 1 cut(s) 89
EcoRV GATATC 1 cut(s) 261
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
Esp3I CGTCTC 1 cut(s) 200
FaeI CATG 4 cut(s) 103, 110, 160, 169
FaiI YATR 5 cut(s) 101, 108, 158, 167, 272
FatI CATG 4 cut(s) 99, 106, 156, 165
FblI GTMKAC 1 cut(s) 56
FokI GGATG 2 cut(s) 174, 253
FspBI CTAG 1 cut(s) 240
Hin1II CATG 4 cut(s) 103, 110, 160, 169
Hpy166II GTNNAC 1 cut(s) 57
Hpy188I TCNGA 3 cut(s) 174, 223, 315
Hpy188III TCNNGA 2 cut(s) 74, 305
Hpy8I GTNNAC 1 cut(s) 57
Hpy99I CGWCG 2 cut(s) 11, 14
HpyAV CCTTC 1 cut(s) 8
HpyCH4III ACNGT 1 cut(s) 211
HpyCH4V TGCA 2 cut(s) 52, 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 162
HpyF3I CTNAG 1 cut(s) 279
Hsp92II CATG 4 cut(s) 103, 110, 160, 169
LpnPI CCDG 2 cut(s) 76, 103
LweI GCATC 1 cut(s) 275
MaeI CTAG 1 cut(s) 240
MboII GAAGA 3 cut(s) 77, 130, 210
MluCI AATT 1 cut(s) 110
MnlI CCTC 2 cut(s) 70, 190
MseI TTAA 1 cut(s) 331
MspR9I CCNGG 1 cut(s) 91
MvaI CCWGG 1 cut(s) 91
MwoI GCNNNNNNNGC 1 cut(s) 162
NlaIII CATG 4 cut(s) 103, 110, 160, 169
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
SaqAI TTAA 1 cut(s) 331
ScrFI CCNGG 1 cut(s) 91
SetI ASST 5 cut(s) 27, 62, 81, 92, 132
SfaNI GCATC 1 cut(s) 275
SfcI CTRYAG 1 cut(s) 192
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 1 cut(s) 110
SspMI CTAG 1 cut(s) 240
StyD4I CCNGG 1 cut(s) 89
StyI CCWWGG 1 cut(s) 60
TaaI ACNGT 1 cut(s) 211
TaqII GACCGA 1 cut(s) 20
TasI AATT 1 cut(s) 110
Tru1I TTAA 1 cut(s) 331
Tru9I TTAA 1 cut(s) 331
TspDTI ATGAA 3 cut(s) 35, 123, 176
XmiI GTMKAC 1 cut(s) 56
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.