Rmu_ssc0000396.1_g000005

Protein of unknown function (DUF789)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000396.1
OG0010858
Physical Location & Seq
Forward (+)
34094 .. 34500
407 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000396.1_g000005.1.cds

Sequence Viewer

Length: 336 bp
atgcgaacaggtctgtgggattttgaattttcgtggggcgagtcggggaaggcggtatatactaggaaacccaatgatcaatccaggttggggatcggctgcacagctaaaccagagagtgactgttggagtgacgatagtgacagcgttaagaaatctgtttcttttagcaatactacttccagcacatatgctacttcagatgattctgtttctaccagtgaccatgagattgaggccgattgccttcaccacctgtattgccagtacaacgaaacatctggtcctcatgatagagttcctttgaccctcaaggcaaatacccctctattttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF789

Protein Analysis

111

Amino Acids

12.35

Weight (kDa)

4.85

Isoelectric Point (pI)

32.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 53
AclWI GGATC 1 cut(s) 101
AcsI RAATTY 1 cut(s) 26
AcuI CTGAAG 1 cut(s) 183
AfaI GTAC 1 cut(s) 269
AfiI CCNNNNNNNGG 1 cut(s) 90
AgsI TTSAA 1 cut(s) 26
AjnI CCWGG 1 cut(s) 83
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AlwI GGATC 1 cut(s) 101
AoxI GGCC 1 cut(s) 237
ApeKI GCWGC 1 cut(s) 99
ApoI RAATTY 1 cut(s) 26
AspS9I GGNCC 1 cut(s) 284
AsuHPI GGTGA 1 cut(s) 242
AvaII GGWCC 1 cut(s) 284
BbvI GCAGC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 85
BclI TGATCA 1 cut(s) 76
BfaI CTAG 1 cut(s) 63
BisI GCNGC 1 cut(s) 100
BlsI GCNGC 1 cut(s) 101
Bme1390I CCNGG 1 cut(s) 85
Bme18I GGWCC 1 cut(s) 284
BmgT120I GGNCC 1 cut(s) 284
BmrFI CCNGG 1 cut(s) 85
BpuEI CTTGAG 1 cut(s) 296
Bsc4I CCNNNNNNNGG 1 cut(s) 90
Bse1I ACTGG 2 cut(s) 219, 265
BseBI CCWGG 1 cut(s) 85
BseLI CCNNNNNNNGG 1 cut(s) 90
BseNI ACTGG 2 cut(s) 219, 265
BseXI GCAGC 1 cut(s) 86
BsgI GTGCAG 1 cut(s) 85
BshFI GGCC 1 cut(s) 239
BslI CCNNNNNNNGG 1 cut(s) 90
BsnI GGCC 1 cut(s) 239
Bsp143I GATC 2 cut(s) 76, 93
BspACI CCGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 239
BspHI TCATGA 1 cut(s) 289
BspPI GGATC 1 cut(s) 101
BsrI ACTGG 2 cut(s) 219, 265
BssMI GATC 2 cut(s) 76, 93
Bst2UI CCWGG 1 cut(s) 85
Bst4CI ACNGT 1 cut(s) 125
BstKTI GATC 2 cut(s) 79, 96
BstMBI GATC 2 cut(s) 76, 93
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 86
BsuRI GGCC 1 cut(s) 239
BtsIMutI CAGTG 1 cut(s) 226
CciI TCATGA 1 cut(s) 289
Cfr13I GGNCC 1 cut(s) 284
Csp6I GTAC 1 cut(s) 268
CspCI CAANNNNNGTGG 2 cut(s) 242, 277
CviAII CATG 2 cut(s) 227, 290
CviJI RGCY 3 cut(s) 99, 107, 239
CviKI_1 RGCY 3 cut(s) 99, 107, 239
CviQI GTAC 1 cut(s) 268
DpnI GATC 2 cut(s) 78, 95
DpnII GATC 2 cut(s) 76, 93
Eco47I GGWCC 1 cut(s) 284
Eco57I CTGAAG 1 cut(s) 183
EcoRII CCWGG 1 cut(s) 83
FaeI CATG 2 cut(s) 230, 293
FaiI YATR 6 cut(s) 58, 60, 190, 192, 228, 291
FatI CATG 2 cut(s) 226, 289
FauNDI CATATG 1 cut(s) 190
FbaI TGATCA 1 cut(s) 76
Fnu4HI GCNGC 1 cut(s) 100
Fsp4HI GCNGC 1 cut(s) 100
FspBI CTAG 1 cut(s) 63
GluI GCNGC 1 cut(s) 100
HaeIII GGCC 1 cut(s) 239
Hin1II CATG 2 cut(s) 230, 293
HinfI GANTC 2 cut(s) 41, 206
HphI GGTGA 1 cut(s) 242
Hpy188I TCNGA 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 290
HpyAV CCTTC 2 cut(s) 43, 257
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4V TGCA 1 cut(s) 102
Hsp92II CATG 2 cut(s) 230, 293
Ksp22I TGATCA 1 cut(s) 76
Kzo9I GATC 2 cut(s) 76, 93
LpnPI CCDG 8 cut(s) 70, 97, 126, 196, 232, 267, 269, 278
Lsp1109I GCAGC 1 cut(s) 86
MaeI CTAG 1 cut(s) 63
MaeIII GTNAC 4 cut(s) 119, 131, 140, 221
MalI GATC 2 cut(s) 78, 95
MboI GATC 2 cut(s) 76, 93
MluCI AATT 1 cut(s) 26
MlyI GAGTC 1 cut(s) 50
MmeI TCCRAC 1 cut(s) 107
MnlI CCTC 4 cut(s) 229, 297, 320, 336
MseI TTAA 2 cut(s) 150, 334
MspR9I CCNGG 1 cut(s) 85
MvaI CCWGG 1 cut(s) 85
NdeI CATATG 1 cut(s) 190
NdeII GATC 2 cut(s) 76, 93
NlaIII CATG 2 cut(s) 230, 293
NmuCI GTSAC 4 cut(s) 119, 131, 140, 221
PagI TCATGA 1 cut(s) 289
PfeI GAWTC 1 cut(s) 206
PkrI GCNGC 1 cut(s) 101
PleI GAGTC 1 cut(s) 49
PpsI GAGTC 1 cut(s) 49
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspPI GGNCC 1 cut(s) 284
RsaI GTAC 1 cut(s) 269
RsaNI GTAC 1 cut(s) 268
SaqAI TTAA 2 cut(s) 150, 334
SatI GCNGC 1 cut(s) 100
Sau3AI GATC 2 cut(s) 76, 93
Sau96I GGNCC 1 cut(s) 284
SchI GAGTC 1 cut(s) 50
ScrFI CCNGG 1 cut(s) 85
SetI ASST 4 cut(s) 13, 89, 109, 258
SinI GGWCC 1 cut(s) 284
SmlI CTYRAG 1 cut(s) 311
SmoI CTYRAG 1 cut(s) 311
Sse9I AATT 1 cut(s) 26
SsiI CCGC 1 cut(s) 53
SspMI CTAG 1 cut(s) 63
StyD4I CCNGG 1 cut(s) 83
TaaI ACNGT 1 cut(s) 125
TasI AATT 1 cut(s) 26
TatI WGTACW 1 cut(s) 267
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 2 cut(s) 150, 334
Tru9I TTAA 2 cut(s) 150, 334
TscAI CASTG 1 cut(s) 226
TseFI GTSAC 4 cut(s) 119, 131, 140, 221
TseI GCWGC 1 cut(s) 99
Tsp45I GTSAC 4 cut(s) 119, 131, 140, 221
TspRI CASTG 1 cut(s) 226
VpaK11BI GGWCC 1 cut(s) 284
XapI RAATTY 1 cut(s) 26
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.