Rorug04G0379500

Protein of unknown function (DUF789)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0010858
Physical Location & Seq
Forward (+)
55021783 .. 55022227
445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0379500.1

Sequence Viewer

Length: 297 bp
ATGAAAGAAAAACCTGGTCTTCAGTTGAGGAGACTAGCTGAGTTCTTAGGGTGCCCATTTTCACCGAAAGAAGAGGCACAGGGAGTGGTGGACAATATCTTAAGGCTGTGTAGTTTTGATAATTTGAGCAATTTGGATGTGAACAAAAATGAGAAATTATCGATAGGGATAGAGAATAGTGCATTCTTTCGGCGAGGGAAGGCGGGAGACTGGAGGAATTATTTGACAGCTGAGATGGTGGAACAACTAGACCGTATCATTGAAGAGAAGTTGCAAGGTTCTGACTTGAAATTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF789

Protein Analysis

98

Amino Acids

11.23

Weight (kDa)

5.5

Isoelectric Point (pI)

61.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sulfotransfer_1 PF00685 1 - 94 2.6e-23 Sulfotransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 51
AciI CCGC 1 cut(s) 203
AcsI RAATTY 1 cut(s) 290
AcuI CTGAAG 1 cut(s) 5
AflII CTTAAG 1 cut(s) 100
AgsI TTSAA 2 cut(s) 263, 289
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 2 cut(s) 38, 230
AluI AGCT 2 cut(s) 38, 230
Alw26I GTCTC 2 cut(s) 25, 201
ApoI RAATTY 1 cut(s) 290
AsuHPI GGTGA 1 cut(s) 54
BaeGI GKGCMC 1 cut(s) 56
BanI GGYRCC 1 cut(s) 51
BbsI GAAGAC 1 cut(s) 11
BccI CCATC 1 cut(s) 229
BciT130I CCWGG 1 cut(s) 15
BcoDI GTCTC 2 cut(s) 25, 201
BfaI CTAG 2 cut(s) 35, 248
BfrI CTTAAG 1 cut(s) 100
Bme1390I CCNGG 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 15
BpiI GAAGAC 1 cut(s) 11
BpmI CTGGAG 1 cut(s) 232
Bsa29I ATCGAT 1 cut(s) 161
Bse1I ACTGG 1 cut(s) 215
BseBI CCWGG 1 cut(s) 15
BseCI ATCGAT 1 cut(s) 161
BseGI GGATG 1 cut(s) 142
BseMII CTCAG 2 cut(s) 30, 222
BseNI ACTGG 1 cut(s) 215
BseRI GAGGAG 1 cut(s) 43
BseSI GKGCMC 1 cut(s) 56
BshNI GGYRCC 1 cut(s) 51
BshVI ATCGAT 1 cut(s) 161
BsmAI GTCTC 2 cut(s) 25, 201
BsmI GAATGC 1 cut(s) 182
Bsp1286I GDGCHC 1 cut(s) 56
BspACI CCGC 1 cut(s) 203
BspCNI CTCAG 2 cut(s) 31, 223
BspDI ATCGAT 1 cut(s) 161
BspLI GGNNCC 1 cut(s) 53
BspT107I GGYRCC 1 cut(s) 51
BspTI CTTAAG 1 cut(s) 100
BsrI ACTGG 1 cut(s) 215
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 254
Bst6I CTCTTC 2 cut(s) 66, 258
BstAFI CTTAAG 1 cut(s) 100
BstDEI CTNAG 3 cut(s) 39, 46, 231
BstF5I GGATG 1 cut(s) 142
BstMAI GTCTC 2 cut(s) 25, 201
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstSLI GKGCMC 1 cut(s) 56
BstV2I GAAGAC 1 cut(s) 11
Bsu15I ATCGAT 1 cut(s) 161
BsuTUI ATCGAT 1 cut(s) 161
BtsCI GGATG 1 cut(s) 142
ClaI ATCGAT 1 cut(s) 161
CsiI ACCWGGT 1 cut(s) 13
CviJI RGCY 3 cut(s) 38, 106, 230
CviKI_1 RGCY 3 cut(s) 38, 106, 230
DdeI CTNAG 3 cut(s) 39, 46, 231
Eam1104I CTCTTC 2 cut(s) 66, 258
EarI CTCTTC 2 cut(s) 66, 258
Eco57I CTGAAG 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 13
FauI CCCGC 1 cut(s) 196
FokI GGATG 1 cut(s) 149
FspBI CTAG 2 cut(s) 35, 248
GsuI CTGGAG 1 cut(s) 232
HphI GGTGA 1 cut(s) 54
Hpy166II GTNNAC 2 cut(s) 91, 142
Hpy188I TCNGA 1 cut(s) 283
Hpy8I GTNNAC 2 cut(s) 91, 142
HpyAV CCTTC 1 cut(s) 193
HpyCH4III ACNGT 1 cut(s) 254
HpyCH4V TGCA 2 cut(s) 182, 274
HpyF3I CTNAG 3 cut(s) 39, 46, 231
LpnPI CCDG 3 cut(s) 27, 65, 196
MabI ACCWGGT 1 cut(s) 13
MaeI CTAG 2 cut(s) 35, 248
MboII GAAGA 3 cut(s) 11, 83, 275
MhlI GDGCHC 1 cut(s) 56
MluCI AATT 5 cut(s) 121, 130, 155, 217, 290
MnlI CCTC 4 cut(s) 21, 67, 188, 207
MseI TTAA 1 cut(s) 101
MspA1I CMGCKG 1 cut(s) 230
MspCI CTTAAG 1 cut(s) 100
MspR9I CCNGG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 182
MvaI CCWGG 1 cut(s) 15
NlaIV GGNNCC 1 cut(s) 53
PctI GAATGC 1 cut(s) 182
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 53
PvuII CAGCTG 1 cut(s) 230
SaqAI TTAA 1 cut(s) 101
ScrFI CCNGG 1 cut(s) 15
SduI GDGCHC 1 cut(s) 56
SetI ASST 4 cut(s) 16, 40, 232, 280
SexAI ACCWGGT 1 cut(s) 13
SgeI CNNG 9 cut(s) 26, 27, 47, 92, 206, 216, 223, 260, 287
SmlI CTYRAG 1 cut(s) 100
SmoI CTYRAG 1 cut(s) 100
Sse9I AATT 5 cut(s) 121, 130, 155, 217, 290
SsiI CCGC 1 cut(s) 203
SspMI CTAG 2 cut(s) 35, 248
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 254
TaqI TCGA 1 cut(s) 161
TasI AATT 5 cut(s) 121, 130, 155, 217, 290
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 17
Vha464I CTTAAG 1 cut(s) 100
XapI RAATTY 1 cut(s) 290
XspI CTAG 2 cut(s) 35, 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.