Rmu_ssc0000420.1_g000015

Fip1 motif

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000420.1
Physical Location & Seq
Forward (+)
87009 .. 87410
402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000420.1_g000015.1.cds

Sequence Viewer

Length: 315 bp
atggcagatttggacgaagatttcggagacatctatactgatgtcgaagcgcaggccacttcagtcatcaatggcgtatcggacttcgctcagttctgtatagaacccgaagaagatagaaatgatagtaacaacaatgcaaagaacagcgagggtttcgtctccgattctaagaaacccaaagaggaattgggtggtaaagtttcgggtattccctttccggtttcagatggaggggccatgaggatagatgattatgaagatgaggatgatgatgatcttgtggccttgaaagattgcaaggtattctattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.43

Weight (kDa)

4.05

Isoelectric Point (pI)

36.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 45
AgsI TTSAA 1 cut(s) 292
Alw26I GTCTC 2 cut(s) 21, 166
AoxI GGCC 3 cut(s) 54, 237, 285
ArsI GACNNNNNNTTYG 1 cut(s) 37
AspLEI GCGC 1 cut(s) 52
AspS9I GGNCC 1 cut(s) 237
BccI CCATC 1 cut(s) 224
BcoDI GTCTC 2 cut(s) 21, 166
BmgT120I GGNCC 1 cut(s) 237
BmiI GGNNCC 1 cut(s) 238
BsaBI GATNNNNATC 1 cut(s) 276
BsaWI WCCGGW 1 cut(s) 220
Bse8I GATNNNNATC 1 cut(s) 276
BseGI GGATG 1 cut(s) 274
BseJI GATNNNNATC 1 cut(s) 276
BseMII CTCAG 1 cut(s) 104
BshFI GGCC 3 cut(s) 56, 239, 287
BsiSI CCGG 1 cut(s) 221
BsmAI GTCTC 2 cut(s) 21, 166
BsmBI CGTCTC 1 cut(s) 166
BsnI GGCC 3 cut(s) 56, 239, 287
Bsp143I GATC 1 cut(s) 277
BspANI GGCC 3 cut(s) 56, 239, 287
BspCNI CTCAG 1 cut(s) 103
BspLI GGNNCC 1 cut(s) 238
BssMI GATC 1 cut(s) 277
BstC8I GCNNGC 1 cut(s) 54
BstDEI CTNAG 2 cut(s) 90, 171
BstF5I GGATG 1 cut(s) 274
BstHHI GCGC 1 cut(s) 52
BstKTI GATC 1 cut(s) 280
BstMAI GTCTC 2 cut(s) 21, 166
BstMBI GATC 1 cut(s) 277
BsuRI GGCC 3 cut(s) 56, 239, 287
BtsCI GGATG 1 cut(s) 274
Cac8I GCNNGC 1 cut(s) 54
CfoI GCGC 1 cut(s) 52
Cfr13I GGNCC 1 cut(s) 237
CviAII CATG 1 cut(s) 241
CviJI RGCY 3 cut(s) 56, 239, 287
CviKI_1 RGCY 3 cut(s) 56, 239, 287
DdeI CTNAG 2 cut(s) 90, 171
DpnI GATC 1 cut(s) 279
DpnII GATC 1 cut(s) 277
Eco57I CTGAAG 1 cut(s) 45
Esp3I CGTCTC 1 cut(s) 166
FaeI CATG 1 cut(s) 244
FaiI YATR 4 cut(s) 36, 101, 242, 258
FatI CATG 1 cut(s) 240
FokI GGATG 1 cut(s) 281
GlaI GCGC 1 cut(s) 51
HaeIII GGCC 3 cut(s) 56, 239, 287
HapII CCGG 1 cut(s) 221
HhaI GCGC 1 cut(s) 52
Hin1II CATG 1 cut(s) 244
Hin6I GCGC 1 cut(s) 50
HinP1I GCGC 1 cut(s) 50
HinfI GANTC 1 cut(s) 167
HpaII CCGG 1 cut(s) 221
Hpy188I TCNGA 4 cut(s) 26, 82, 166, 229
HpyCH4V TGCA 2 cut(s) 140, 300
HpyF3I CTNAG 2 cut(s) 90, 171
Hsp92II CATG 1 cut(s) 244
HspAI GCGC 1 cut(s) 50
Kzo9I GATC 1 cut(s) 277
LpnPI CCDG 2 cut(s) 38, 234
MaeIII GTNAC 1 cut(s) 128
MalI GATC 1 cut(s) 279
MboI GATC 1 cut(s) 277
MboII GAAGA 4 cut(s) 29, 122, 125, 272
MluCI AATT 1 cut(s) 188
MnlI CCTC 5 cut(s) 145, 178, 227, 237, 259
MspI CCGG 1 cut(s) 221
NdeII GATC 1 cut(s) 277
NlaIII CATG 1 cut(s) 244
NlaIV GGNNCC 1 cut(s) 238
PfeI GAWTC 1 cut(s) 167
PspN4I GGNNCC 1 cut(s) 238
PspPI GGNCC 1 cut(s) 237
Sau3AI GATC 1 cut(s) 277
Sau96I GGNCC 1 cut(s) 237
SetI ASST 1 cut(s) 306
SgeI CNNG 8 cut(s) 65, 119, 163, 219, 233, 253, 293, 301
Sse9I AATT 1 cut(s) 188
TaqI TCGA 1 cut(s) 45
TasI AATT 1 cut(s) 188
TfiI GAWTC 1 cut(s) 167
TspDTI ATGAA 1 cut(s) 273
XcmI CCANNNNNNNNNTGG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.